Difference between revisions of "Part:BBa K4221026"

 
(→‎Design Consideration)
 
(One intermediate revision by the same user not shown)
Line 2: Line 2:
 
__NOTOC__
 
__NOTOC__
 
<partinfo>BBa_K4221026 short</partinfo>
 
<partinfo>BBa_K4221026 short</partinfo>
−
 
−
 
−
 
−
 
−
<!-- Add more about the biology of this part here
 
−
===Usage and Biology===
 
  
 
<!-- -->
 
<!-- -->
Line 18: Line 12:
 
<partinfo>BBa_K4221026 parameters</partinfo>
 
<partinfo>BBa_K4221026 parameters</partinfo>
 
<!-- -->
 
<!-- -->
 +
 +
===Usage===
 +
Aqueous two-phase separation (ATPS) is a liquid-liquid fractionation technique effectively used for protein separation and purification[1]. When a protein fuses with a hydrophobin, the hydrophobin changes the hydrophobicity of the protein, which causes the protein to aggregate into the surfactants.
 +
 +
Our team is trying to improve traditional ATPS by incorporating a continuous-flow system and replacing fungal hydrophobins with BslA.
 +
Using mHoneydew[2] as target protein can visually observe fluorescent protein (mHoneydew,target protein) showing orange fluorescence in the process of protein expression and two-phase extraction, so as to determine the separation and purification effect.
 +
 +
===Biology===
 +
Conventional Orange FPs are mainly derived from two parental proteins: Kusabira-Orange (KO) and DsRed. KO was originally isolated from stony coral Fungiaconcinna, which provides bright orange fluorescence to proteins by introducing 10 amino acid residues at its N terminus. Shaner et al. improved mHoneydew and mOrange on the basis of mRFP1, a single molecule variant of DsRed.[3]
 +
 +
===Design Consideration===
 +
The construction includes:
 +
 +
mHoneydew is fused with a GS linker（GGTGGTGGCGGCAGCGGCGGAGGCGGTAGT）
 +
 +
===Reference===
 +
[1] E Mustalahti, M Saloheimo, J J. JoensuuIntracellular protein production in Trichodermareesei (Hypocreajecorina) with hydrophobin fusion technology[J]. New Biotechnology, 2013(30)
 +
 +
[2]Aijia J, Xibin N. Construction and Expression of Prokaryotic Expression Vector pET28a-EGFP[J]. JOURNAL OF MICROBIOLOGY, 2011, 31(4):69-73.
 +
 +
[3]Peng W, He P, Shi D, etal. Advances in the research and applications of orange fluorescent protein[J]. Journal of Biotechnology, 2020, 36(6):1060−1068.
 +
 +
 +
<!-- Add more about the biology of this part here
 +
===Usage and Biology===

Latest revision as of 16:14, 10 October 2022


mHoneydew-GSlinker

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal NgoMIV site found at 104
    Illegal AgeI site found at 555
  • 1000
    COMPATIBLE WITH RFC[1000]


Usage

Aqueous two-phase separation (ATPS) is a liquid-liquid fractionation technique effectively used for protein separation and purification[1]. When a protein fuses with a hydrophobin, the hydrophobin changes the hydrophobicity of the protein, which causes the protein to aggregate into the surfactants.

Our team is trying to improve traditional ATPS by incorporating a continuous-flow system and replacing fungal hydrophobins with BslA. Using mHoneydew[2] as target protein can visually observe fluorescent protein (mHoneydew,target protein) showing orange fluorescence in the process of protein expression and two-phase extraction, so as to determine the separation and purification effect.

Biology

Conventional Orange FPs are mainly derived from two parental proteins: Kusabira-Orange (KO) and DsRed. KO was originally isolated from stony coral Fungiaconcinna, which provides bright orange fluorescence to proteins by introducing 10 amino acid residues at its N terminus. Shaner et al. improved mHoneydew and mOrange on the basis of mRFP1, a single molecule variant of DsRed.[3]

Design Consideration

The construction includes:

mHoneydew is fused with a GS linker（GGTGGTGGCGGCAGCGGCGGAGGCGGTAGT）

Reference

[1] E Mustalahti, M Saloheimo, J J. JoensuuIntracellular protein production in Trichodermareesei (Hypocreajecorina) with hydrophobin fusion technology[J]. New Biotechnology, 2013(30)

[2]Aijia J, Xibin N. Construction and Expression of Prokaryotic Expression Vector pET28a-EGFP[J]. JOURNAL OF MICROBIOLOGY, 2011, 31(4):69-73.

[3]Peng W, He P, Shi D, etal. Advances in the research and applications of orange fluorescent protein[J]. Journal of Biotechnology, 2020, 36(6):1060−1068.