Difference between revisions of "Part:BBa K4221021"
(→Design Consideration) |
|||
Line 21: | Line 21: | ||
===Design Consideration=== | ===Design Consideration=== | ||
The construction includes: | The construction includes: | ||
− | BslA with a TEV | + | BslA with a TEV linker(GAAAACCTGTACTTCCAGGGTTCTGGT) |
− | + | ||
<!-- Add more about the biology of this part here | <!-- Add more about the biology of this part here | ||
===Usage and Biology=== | ===Usage and Biology=== |
Latest revision as of 16:11, 10 October 2022
mPETase-GSlinker
Sequence and Features
Assembly Compatibility:
- 10INCOMPATIBLE WITH RFC[10]Illegal PstI site found at 783
- 12INCOMPATIBLE WITH RFC[12]Illegal PstI site found at 783
- 21COMPATIBLE WITH RFC[21]
- 23INCOMPATIBLE WITH RFC[23]Illegal PstI site found at 783
- 25INCOMPATIBLE WITH RFC[25]Illegal PstI site found at 783
Illegal NgoMIV site found at 58
Illegal NgoMIV site found at 112
Illegal NgoMIV site found at 139 - 1000COMPATIBLE WITH RFC[1000]
Usage
PET hydrolase (PETase), which hydrolyzes polyethylene terephthalate (PET) into soluble building blocks, provides an attractive avenue for the bioconversion of plastics.
Biology
PETase is a plastic degrading enzyme derived from Ideonella sakaiensis, mPETase is a complicated mutation of PETase, which contains 11 mutation sites: S214H-I168R-W159H-S188Q-R280A-A180I-G165A-Q119Y-L117F-T140D-S121E.
Design Consideration
The construction includes: BslA with a TEV linker(GAAAACCTGTACTTCCAGGGTTCTGGT)