Difference between revisions of "Part:BBa K4221005"
| Line 30: | Line 30: | ||
After the cells of the recombinant strains were induced, centrifuged, and sonicated, the soluble proteins expressed by the strains were all in the supernatant | After the cells of the recombinant strains were induced, centrifuged, and sonicated, the soluble proteins expressed by the strains were all in the supernatant | ||
| + | [[File:figure-8 .png|500px]]<br> | ||
Figure 1. Water contact angle. | Figure 1. Water contact angle. | ||
===Aqueous two-phase separation (ATPS) Testing=== | ===Aqueous two-phase separation (ATPS) Testing=== | ||
| − | + | We used 1×PBS as a blank control, we added isobutanol to the protein supernatant, shaken and let stand for a few minutes until the two phases were clearly separated. | |
| − | + | ||
| − | + | ||
| + | [[File:figure-9 c .png|500px]]<br> | ||
| + | '''Figure 2.''' ATPS testing. | ||
===Reference=== | ===Reference=== | ||
Revision as of 11:09, 10 October 2022
mHoneydew
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25INCOMPATIBLE WITH RFC[25]Illegal NgoMIV site found at 104
Illegal AgeI site found at 555 - 1000COMPATIBLE WITH RFC[1000]
Usage
Aqueous two-phase separation (ATPS) is a liquid-liquid fractionation technique effectively used for protein separation and purification[1]. When a protein fuses with a hydrophobin, the hydrophobin changes the hydrophobicity of the protein, which causes the protein to aggregate into the surfactants. Our team is trying to improve traditional ATPS by incorporating a continuous-flow system and replacing fungal hydrophobins with BslA. Using mHoneydew[2] as target proteincan visually observe fluorescent protein (mHoneydew,target protein) showing orange fluorescence in the process of protein expression and two-phase extraction, so as to determine the separation and purification effect.
Biology
Conventional Orange FPs are mainly derived from two parental proteins: Kusabira-Orange (KO) and DsRed. KO was originally isolated from stony coral Fungiaconcinna, which provides bright orange fluorescence to proteins by introducing 10 amino acid residues at its N terminus. Shaner et al. improved mHoneydew and mOrange on the basis of mRFP1, a single molecule variant of DsRed.[3]
Design Consideration
The construct was cloned into a PET28a plasmid and transformed into mHoneydew-PET28a [2] The construction includes: mHoneydew is fused with BslA with a GS linker（GGTGGTGGCGGCAGCGGCGGAGGCGGTAGT） and TEVlinker（GAAAACCTGTACTTCCAGGGTTCTGGT）
Detection of fusion protein function
After the cells of the recombinant strains were induced, centrifuged, and sonicated, the soluble proteins expressed by the strains were all in the supernatant
Figure 1. Water contact angle.
Aqueous two-phase separation (ATPS) Testing
We used 1×PBS as a blank control, we added isobutanol to the protein supernatant, shaken and let stand for a few minutes until the two phases were clearly separated.
Figure 2. ATPS testing.
Reference
[1] E Mustalahti, M Saloheimo, J J. JoensuuIntracellular protein production in Trichodermareesei (Hypocreajecorina) with hydrophobin fusion technology[J]. New Biotechnology, 2013(30) [2]Aijia J, Xibin N. Construction and Expression of Prokaryotic Expression Vector pET28a-EGFP[J]. JOURNAL OF MICROBIOLOGY, 2011, 31(4):69-73. [3]Peng W, He P, Shi D, etal. Advances in the research and applications of orange fluorescent protein[J]. Journal of Biotechnology, 2020, 36(6):1060−1068.