Difference between revisions of "Part:BBa K4197007"

Revision as of 23:07, 8 October 2022

Ana o 3 expression at the surface of E. coli cells sortable by FACS using mRFP1

OmpA_ana o 3 fusion to display cashew allergen.

Introduction

This part is composed of the gene coding for the allergen of cashew Ana o 3 (NCBI: AAL91665.1). The cashew allergy prevalence is higher than 0.08% (Van der Valk and al. 2014) in the US countries and Ana o 3 binds specific antibodies of 100% of the patients with cashew allergy (Sato and al. 2019). Ana o 3 have already been expressed in E. coli and was able to bind the IgE of patient with cashew allergie (Robotham and al. 2005).Ana o 3 was merged to the membrane protein OmpA of E. coli (BBa_K1694002), to display Ana o 3 on the surface of E. coli . This lipoprotein is the most abundant in E. coli's membrane with 100,000 copies per cell (Ortiz-Suarez and al. 2016) and is often used to display protein on the surface of bacteria (Yang and al. 2016).

Construction

Ana o 3 gene ordered on IDT (shown above in Figure 12) was amplified by PCR using the high fidelity Phusion polymerase with the primers IF3_allergen (gccgcaagctttaatgatggtgatggtgatggtgatg) F and IF4_Ana o 3 (cctgtattttcagagcatggcgaaatttcttttattattg). Expected size of the amplicon was 479 bp.

Amplification product sizes were checked on EtBr stained agarose gel (Figure 13).

Figure 13: Ana o 3 amplified fragment. Expected size of the amplicons was 479 bp. PCR amplicon sizes Ana o 3 were checked with agarose electrophoresis gel and revealed with EtBr. A theoretical gel is presented with each gel and the NEB 1 kb DNA ladder is used for the experimental gels (note that a different ladder is presented on the theoretical gel).

The products matched expected sizes and amplicons were further purified from the gel. The Ana o 3 construction was inserted into pET-21 b (+)_OmpA linearized (see Figure 6) by In-Fusion.

In-Fusion assemby reaction was transformed into Stellar competent cells. Transformants were selected on LB-ampicillin plates. 15 transformants were screened by colony PCR with primer pairs flanking the insertion zone (primers used: screening_inserts-F: ggttatgctagttattgctcagc and screening_inserts-R: ccgaaacaagcgctcatgagc). 4 positive transformants were detected (Figure 14).

Figure 14: pET21 b (+)_OmpA_Ana o 3 construction fragments from colony PCR. PCR amplicon sizes of colonies with Ana o 3 plasmid were checked with agarose electrophoresis gel and revealed with EtBr. A theoretical gel is presented with each gel and the NEB 1 kb DNA ladder is used for the experimental gels (note that a different ladder is presented on the theoretical gel).

These transformants (colonies 1, 3 and 9) had their plasmid extracted by Miniprep and digested by Eco-RI and Eco-RV (expected size of the fragments: 5052 bp and 3211 pb) to assess the assembly (Figure 15).

Figure 15: restriction profile of pET-21 b (+)_Ana o 3 final construction. Enzymes were EcoRI and EcoRV. Plasmids were checked with agarose electrophoresis gel and revealed with EtBr. A theoretical gel is presented with each gel and the NEB 1 kb DNA ladder is used for the experimental gels (note that a different ladder is presented on the theoretical gel).

The correct restriction maps were observed and these clones were further validated by sequencing. The plasmid was named pET-21 b (+)_OmpA_Ana o 3.

The plasmid was finally used to transform E. coli Tuner cells to express the OmpA_Ana o 3 construction at the cell membrane.

Achievements so far: we managed to have all our allergen construction correctly cloned.

Validation

References

More information about the project for which the part was created: DAISY (INSA-UPS 2022)

Other parts to display allergens:
- OmpA_Ara h 2
- OmpA_Der p 2
- OmpA_Gal d 2

Sequence and Features