Difference between revisions of "Part:BBa K4197007"
Line 3: Line 3:
 
<partinfo>BBa_K4197003 short</partinfo>
 
<partinfo>BBa_K4197003 short</partinfo>
  
−
Brick expressing Ana o 3 at the surface of E. coli cell sortable by FACS
+
OmpA_ana o 3 fusion to display cashew allergen.
  
 
<html>
 
<html>
  
 
<h2>Introduction</h2>
 
<h2>Introduction</h2>
−
<p>The part expressing the gene of cashew nut Ana o 3 (<a href="https://parts.igem.org/Part:BBa_K4197007">K4197007</a>) has been completed with the ihfb800-RFP construction
+
<p>This part is composed of the gene coding for the allergen of cashew Ana o 3 (NCBI: <a "https://www.ncbi.nlm.nih.gov/protein/AAL91665.1/">AAL91665.1</a>). The cashew allergy prevalence is higher than 0.08% (Van der Valk and al. 2014) in the US countries and Ana o 3 binds specific antibodies of 100% of the patients with cashew allergy  (Sato and al. 2019). Ana o 3 have already been expressed in <i>E. coli </i>and was able to bind the IgE of patient with cashew allergie (Robotham and al. 2005).Ana o 3 was merged to the membrane protein OmpA of <i>E. coli</i> (<a href="https://parts.igem.org/Part:BBa_K1694002">BBa_K1694002</a>), to display Ana o 3 on the surface of <i>E. coli </i>. This lipoprotein is the most abundant in <i>E. coli's </i>membrane with 100,000 copies per cell (Ortiz-Suarez and al. 2016) and is often used to display protein on the surface of bacteria (Yang and al. 2016).</p>
−
(<a href="https://parts.igem.org/Part:BBa_K41970012">K41970012</a>) to express red
+
−
fluorescence. This red fluorescence allows sorting of bacteria by FACS. </p>
+
  
 
<h2>Construction</h2>
 
<h2>Construction</h2>
−
<p>The ihfb800-mRFP1 construction was amplified by PCR with the high-fidelity Phusion polymerase using BFP/RFP IF+BglII R site R
 
−
(cgcgggatcgagatctatcacgaggcagaatttcagat) and BFP/RFP IF+BglII R site F (tagaggatcgagatctctgaaacagtgcaaagctaaccc) primers. The expected size of the amplicon is 1622
 
−
bp. The fragment was inserted on the linearized plasmid pET21b(+) with Ana o 3 (<a href="https://parts.igem.org/Part:BBa_K4197007">K4197007</a>) by In-Fusion. </p>
 
−
<p>The resulting products were transformed into Stellar cells and transformants were selected. Colonies were screened by PCR using screening_insert_R
 
−
(ccgaaacaagcgctcatgagc) and screening_insert_F (ggttatgctagttattgctcagc) primers. The expected sizes of amplicons was 2944 bp with RFP and 1453 bp without RFP.</p>
 
−
   
 
  
−
<div class="center">
 
−
        <div class="thumb tnone">
 
−
            <div class="thumbinner" style="width:50%;">
 
−
                <a href="https://static.igem.wiki/teams/4197/wiki/parts/raph/anao3-check.png" class="image">
 
−
                    <img alt="" src="https://static.igem.wiki/teams/4197/wiki/parts/raph/anao3-check.png" width="100%" height=auto class="thumbimage" /></a>                  <div class="thumbcaption">
 
−
                    <div class="magnify">
 
−
                        <a href="https://static.igem.wiki/teams/4197/wiki/parts/raph/anao3-check.png" class="internal" title="Enlarge"></a>
 
−
                    </div>
 
−
                    <b>Figure 1: </b> <b>Verification of the insertion of RFP fragment in Ana o 3 with gel.</b> 
 
−
The PCR screening was checked with 0.6% agarose electrophoresis gel and revealed with EtBr. A theoretical gel is presented with each gel and the
 
−
NEB 1 kb DNA ladder is used for the experimental gels (note that a different ladder is presented on the theoretical gel). Colony 8 has shown the
 
−
right size.
 
−
                </div>
 
−
            </div>
 
−
        </div>
 
−
    </div>
 
−
 
 
 
 
<h2>Validation</h2>
 
<h2>Validation</h2>
−
<p>Successful colonies were further tested by digestion with NotI which cut both in the plasmid and in the mRFP1 gene (Figure 2). Correct sizes were expected to be
 
−
1178 and 6791 bp for Ara h 2.</p>
 
−
<div class="center">
 
−
    <div class="thumb tnone">
 
−
        <div class="thumbinner" style="width:80%;">
 
−
            <a href="https://static.igem.wiki/teams/4197/wiki/parts/raph/anao3-dig.png" class="image">
 
−
                <img alt="" src="https://static.igem.wiki/teams/4197/wiki/parts/raph/anao3-dig.png" width="100%" height=auto class="thumbimage" /></a>                  <div class="thumbcaption">
 
−
                <div class="magnify">
 
−
                    <a href="https://static.igem.wiki/teams/4197/wiki/parts/raph/anao3-dig.png" class="internal" title="Enlarge"></a>
 
−
                </div>
 
−
                <b>Figure 2: </b> <b>Digestion by NotI of Ana o 3 with mRFP1 insertion.</b> 
 
−
                The digestion product was checked with 0.6% agarose electrophoresis gel and revealed with EtBr. A theoretical gel is presented with each gel and the
 
−
NEB 1 kb DNA ladder is used for the experimental gels (note that a different ladder is presented on the theoretical gel). colonies 21 and 23 present
 
−
the correct size for Ana o 3.
 
−
            </div>
 
−
        </div>
 
−
    </div>
 
−
</div>
 
  
−
<p>This construction has not shown red fluorescence on the microscope. After sequencing, a mutation has been revealed on the mRFP sequence which does not allow us
 
−
to continue further with this construction.</p>
 
 
      
 
      
 
<h2>References</h2>
 
<h2>References</h2>
−
<ol>
+
<p>More information about the project for which the part was created:<a href="https://2022.igem.wiki/toulouse-insa-ups/index.html"> DAISY (INSA-UPS 2022)</a> </p>
−
<li> <a href="https://parts.igem.org/Part:BBa_K4197007">K4197007</a> </li>
+
 
−
<li> <a href="https://parts.igem.org/Part:BBa_K4197012">K4197012</a> </li>
+
<p>Other parts to display allergens:<br>
−
<li> <a href="https://2022.igem.wiki/toulouse-insa-ups/index.html"> DAISY (INSA-UPS 2022)</a> </li>
+
    - <a href="https://parts.igem.org/Part:BBa_K4197008"> OmpA_Ara h 2</a> <br>
−
</ol>
+
    - <a href="https://parts.igem.org/Part:BBa_K4197006"> OmpA_Der p 2</a> <br>
 +
    - <a href="https://parts.igem.org/Part:BBa_K4197009"> OmpA_Gal d 2</a> <br>
 +
</p>
  
  

Revision as of 23:00, 8 October 2022


Ana o 3 expression at the surface of E. coli cells sortable by FACS using mRFP1

OmpA_ana o 3 fusion to display cashew allergen.

Introduction

This part is composed of the gene coding for the allergen of cashew Ana o 3 (NCBI: AAL91665.1). The cashew allergy prevalence is higher than 0.08% (Van der Valk and al. 2014) in the US countries and Ana o 3 binds specific antibodies of 100% of the patients with cashew allergy (Sato and al. 2019). Ana o 3 have already been expressed in E. coli and was able to bind the IgE of patient with cashew allergie (Robotham and al. 2005).Ana o 3 was merged to the membrane protein OmpA of E. coli (BBa_K1694002), to display Ana o 3 on the surface of E. coli . This lipoprotein is the most abundant in E. coli's membrane with 100,000 copies per cell (Ortiz-Suarez and al. 2016) and is often used to display protein on the surface of bacteria (Yang and al. 2016).

Construction

Validation

References

More information about the project for which the part was created: DAISY (INSA-UPS 2022)

Other parts to display allergens:
- OmpA_Ara h 2
- OmpA_Der p 2
- OmpA_Gal d 2

Sequence and Features


Assembly Compatibility:
  • 10
    INCOMPATIBLE WITH RFC[10]
    Illegal EcoRI site found at 1527
    Illegal EcoRI site found at 1741
    Illegal XbaI site found at 1512
    Illegal XbaI site found at 1658
    Illegal PstI site found at 213
    Illegal PstI site found at 224
    Illegal PstI site found at 342
  • 12
    INCOMPATIBLE WITH RFC[12]
    Illegal EcoRI site found at 1527
    Illegal EcoRI site found at 1741
    Illegal NheI site found at 1703
    Illegal PstI site found at 213
    Illegal PstI site found at 224
    Illegal PstI site found at 342
    Illegal NotI site found at 1519
    Illegal NotI site found at 2697
  • 21
    INCOMPATIBLE WITH RFC[21]
    Illegal EcoRI site found at 1527
    Illegal EcoRI site found at 1741
    Illegal BglII site found at 1592
    Illegal BamHI site found at 1735
    Illegal XhoI site found at 2706
  • 23
    INCOMPATIBLE WITH RFC[23]
    Illegal EcoRI site found at 1527
    Illegal EcoRI site found at 1741
    Illegal XbaI site found at 1512
    Illegal XbaI site found at 1658
    Illegal PstI site found at 213
    Illegal PstI site found at 224
    Illegal PstI site found at 342
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal EcoRI site found at 1527
    Illegal EcoRI site found at 1741
    Illegal XbaI site found at 1512
    Illegal XbaI site found at 1658
    Illegal PstI site found at 213
    Illegal PstI site found at 224
    Illegal PstI site found at 342
    Illegal AgeI site found at 329
    Illegal AgeI site found at 1360
    Illegal AgeI site found at 1472
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Illegal SapI.rc site found at 2368