Difference between revisions of "Part:BBa K4197018"
 
(29 intermediate revisions by one other user not shown)
Line 1: Line 1:
−
 
 
__NOTOC__
 
__NOTOC__
 
<partinfo>BBa_K4197018 short</partinfo>
 
<partinfo>BBa_K4197018 short</partinfo>
  
−
Gene coding for the egg allergen called Gal d 2.
+
Gene coding for the egg allergen Gal d 2  
  
 
<html>
 
<html>
  
 
<h2>Introduction</h2>
 
<h2>Introduction</h2>
−
<p>Xxxxx xxxxx xxxxx xxxxxx xxxx</p>
+
<p>This part is composed of the gene coding for the allergen of hen’s egg Gal d 2 (NCBI: <a "https://www.ncbi.nlm.nih.gov/nuccore/V00383.1/">V00383.1</a>). The hen's egg allergy prevalence is 0,5-2,5% in developed countries and Gal d 2 compose 54% of its dry mass (Palosuo and al. 2018). Gal d 2 have already been expressed in <i>E. coli </i>and was able to bind the IgE of patient with egg's allergie (Dhanapala and al. 2015).</p>
  
 
<h2>Construction</h2>
 
<h2>Construction</h2>
−
<p>Xxxxx xxxxx xxxxx xxxxxx xxxx</p>
+
<p>The objective of the INSA-UPS 2022 team was to display Gal d 2 on the surface of <i>E. coli</i> so the ordered sequence was merged to OmpA membrane lipoprotein (see part <a href="https://parts.igem.org/Part:BBa_K4197009">BBa_K1694009</a>).</p>
−
   
+
  
−
<div class="center">
 
−
        <div class="thumb tnone">
 
−
            <div class="thumbinner" style="width:50%;">
 
−
                <a href="/File:T--Toulouse-INSA-UPS--Registry--Youn--CerberusCloning.png" class="image">
 
−
                    <img alt="" src="/wiki/images/7/7e/T--Toulouse-INSA-UPS--Registry--Youn--CerberusCloning.png" width="100%" height=auto class="thumbimage" /></a>                  <div class="thumbcaption">
 
−
                    <div class="magnify">
 
−
                        <a href="/File:T--Toulouse-INSA-UPS--Registry--Youn--CerberusCloning.png" class="internal" title="Enlarge"></a>
 
−
                    </div>
 
−
                    <b>Figure 1: </b> <b>Xxxxxx</b> 
 
−
                  Xxxxxxxxxxxxxxxxxxxxxxxxxxx.
 
−
                </div>
 
−
            </div>
 
−
        </div>
 
−
    </div>
 
−
<h2>Xxxxxxxxx</h2>
 
−
<p>Xxxxxxxxxxxxx</p>
 
−
<div class="center">
 
−
    <div class="thumb tnone">
 
−
        <div class="thumbinner" style="width:80%;">
 
−
            <a href="http://2018.igem.org/File:T--Toulouse-INSA-UPS--Team--Callum-Model-5step_dist.gif" class="image">
 
−
                <img alt="" src="https://static.igem.org/mediawiki/2018/5/5b/T--Toulouse-INSA-UPS--Team--Callum-Model-5step_dist.gif" width="100%" height=auto class="thumbimage" /></a>                  <div class="thumbcaption">
 
−
                <div class="magnify">
 
−
                    <a href="http://2018.igem.org/File:T--Toulouse-INSA-UPS--Team--Callum-Model-5step_dist.gif" class="internal" title="Enlarge"></a>
 
−
                </div>
 
−
                <b>Figure 2: </b> <b>Xxxxxxxxxxxxx</b> 
 
−
                Xxxxxxxxxxxxx.
 
−
            </div>
 
−
        </div>
 
−
    </div>
 
−
</div>
 
−
   
 
−
<h2>titre 2</h2>
 
−
<h3>Titre 3</h3>
 
−
<p>Xxxxxxxxxx</p>
 
−
<ul>
 
−
    <li>Forward : TAAGAAGGAGATATACCATGGCGGAAGCGGGTATCACC</li>
 
−
    <li>Reverse : CTCGAGTGCGGCCGCAAGCTTCGGATCGTCCTATGATGGAGG</li>
 
−
</ul>
 
−
<p>Xxxxxxxxxx</p>
 
−
<ul>
 
−
    <li>CForward : CGCGGCCGCTTCTAGAGCGGAAGCGGGTATCACC</li>
 
−
    <li>Reverse : AGCGGCCGCTACTAGTCGGATCGTCCTATGATGGAGG</li>
 
−
</ul>
 
  
 +
<h2>References</h2>
 +
<p>More information about the project for which the part was created:<a href="https://2022.igem.wiki/toulouse-insa-ups/index.html"> DAISY (INSA-UPS 2022)</a> </p>
  
−
<h3>titre 3</h3>
+
<p>Other parts to display allergens:<br>
−
     <h4>Titre 4</h4>
+
    - <a href="https://parts.igem.org/Part:BBa_K4197008"> OmpA_Ara h 2</a> <br>
−
<p>Xxxxxx</p>
+
     - <a href="https://parts.igem.org/Part:BBa_K4197007"> OmpA_Ana o 3</a> <br>
 +
    - <a href="https://parts.igem.org/Part:BBa_K4197006"> OmpA_Der p 1</a> <br>
 +
</p>
  
−
                 
 
−
<h4>Titre 4</h4>
 
−
<p>xxxxxxx</p>
 
−
 
−
<h2>Titre 2</h2>
 
−
<p>Xxxxxx</p>
 
−
<h2>References</h2>
 
 
<ol>
 
<ol>
−
    <i>
+
     <li>Dhanapala, P., Doran, T., Tang, M. L. K., & Suphioglu, C. (2015). Production and immunological analysis of IgE reactive recombinant egg white allergens expressed in Escherichia coli. Molecular Immunology, 65(1), 104–112. https://doi.org/10.1016/j.molimm.2015.01.006</li>
−
     <li>Morag E, Lapidot A, Govorko D, Lamed R, Wilchek M, Bayer EA, Shoham Y: Expression, purification, and characterization of the cellulose-binding domain of the scaffoldin subunit from the cellulosome of Clostridium thermocellum. Applied and Environmental Microbiology 1995, 61:1980-1986.</li>
+
 
−
    <li>Nogueira ES, Schleier T, Durrenberger M, Ballmer-Hofer K, Ward TR, Jaussi R: High-level secretion of recombinant full-length streptavidin in Pichia pastoris and its application to enantioselective catalysis. Protein Expr Purif 2014, 93:54-62. DOI: 10.1016/j.pep.2013.10.015.</li>
+
     <li>Palosuo, K., Kukkonen, A. K., Pelkonen, A. S., & Mäkelä, M. J. (2018). Gal d 1-specific IgE predicts allergy to heated egg in Finnish children. Pediatric Allergy and Immunology, 29(6), 637–643. https://doi.org/10.1111/pai.12954</li>
−
     <li>Young TS, Schultz PG: Beyond the canonical 20 amino acids: expanding the genetic lexicon. J Biol Chem 2010, 285:11039-11044. DOI: 10.1074/jbc.R109.091306.</li>
+
 
−
</i>
+
 
</ol>
 
</ol>
 
</html>
 
</html>

Latest revision as of 08:27, 8 October 2022

Gene coding for Gal d 2

Gene coding for the egg allergen Gal d 2

Introduction

This part is composed of the gene coding for the allergen of hen’s egg Gal d 2 (NCBI: V00383.1). The hen's egg allergy prevalence is 0,5-2,5% in developed countries and Gal d 2 compose 54% of its dry mass (Palosuo and al. 2018). Gal d 2 have already been expressed in E. coli and was able to bind the IgE of patient with egg's allergie (Dhanapala and al. 2015).

Construction

The objective of the INSA-UPS 2022 team was to display Gal d 2 on the surface of E. coli so the ordered sequence was merged to OmpA membrane lipoprotein (see part BBa_K1694009).

References

More information about the project for which the part was created: DAISY (INSA-UPS 2022)

Other parts to display allergens:
- OmpA_Ara h 2
- OmpA_Ana o 3
- OmpA_Der p 1

  1. Dhanapala, P., Doran, T., Tang, M. L. K., & Suphioglu, C. (2015). Production and immunological analysis of IgE reactive recombinant egg white allergens expressed in Escherichia coli. Molecular Immunology, 65(1), 104–112. https://doi.org/10.1016/j.molimm.2015.01.006
  2. Palosuo, K., Kukkonen, A. K., Pelkonen, A. S., & Mäkelä, M. J. (2018). Gal d 1-specific IgE predicts allergy to heated egg in Finnish children. Pediatric Allergy and Immunology, 29(6), 637–643. https://doi.org/10.1111/pai.12954

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    INCOMPATIBLE WITH RFC[12]
    Illegal NheI site found at 114
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Illegal SapI.rc site found at 325