Difference between revisions of "Part:BBa K4197018"
Laurelamothe (Talk | contribs) |
Laurelamothe (Talk | contribs) |
||
Line 11: | Line 11: | ||
<h2>Construction</h2> | <h2>Construction</h2> | ||
− | <p>OmpA_Gal d 2 fragment from IDT gblock was amplified by PCR using the high fidelity Phusion polymerase with primers | + | <p>OmpA_Gal d 2 fragment from IDT gblock was amplified by PCR using the high fidelity Phusion polymerase with primers FORWARD: gccgcaagctttaatgatggtgatggtgatggtgatg) and REVERSE: cgagctccgtcgacaaggaggtaatatacatatgaaagcc. Expected size of the amplicon was 1675 bp.</p> |
− | <p>pET-21 b (+) vector was linearized by PCR using the high fidelity Phusion polymerase with primers | + | <p>pET-21 b (+) vector was linearized by PCR using the high fidelity Phusion polymerase with primers FORWARD:tgtcgacggagctcgaattcg and REVERSE:ttaaagcttgcggccgcactcg. Expected size of the amplicon was 5442 bp.</p> |
<p>Amplification product sizes were checked on EtBr stained agarose gel (Figure 1).</p> | <p>Amplification product sizes were checked on EtBr stained agarose gel (Figure 1).</p> | ||
Line 27: | Line 27: | ||
<p>Amplification products matched the expected size, they were further purified from gel.</p> | <p>Amplification products matched the expected size, they were further purified from gel.</p> | ||
− | <p>The Gal d 2-OmpA construction was then inserted into pET-21 b (+) by In-Fusion. The resulting products were transformed into Stellar competent cells. Transformants were selected on LB-ampicillin plates. 20 transformants were screened by colony PCR with primer pairs flanking the insertion zone ( | + | <p>The Gal d 2-OmpA construction was then inserted into pET-21 b (+) by In-Fusion. The resulting products were transformed into Stellar competent cells. Transformants were selected on LB-ampicillin plates. 20 transformants were screened by colony PCR with primer pairs flanking the insertion zone ( FORWARD: ggttatgctagttattgctcagc and REVERSE: ccgaaacaagcgctcatgagc, expected size of the amplicon : 2092 bp). 2 positive transformants were detected (Figure 3).</p> |
<figure class="normal mx-auto" style="width: 40vw;height: auto"> | <figure class="normal mx-auto" style="width: 40vw;height: auto"> |
Revision as of 13:56, 5 October 2022
Gene coding for Gal d 2
Gene coding for the egg allergen called Gal d 2.
Introduction
Xxxxx xxxxx xxxxx xxxxxx xxxx
Construction
OmpA_Gal d 2 fragment from IDT gblock was amplified by PCR using the high fidelity Phusion polymerase with primers FORWARD: gccgcaagctttaatgatggtgatggtgatggtgatg) and REVERSE: cgagctccgtcgacaaggaggtaatatacatatgaaagcc. Expected size of the amplicon was 1675 bp.
pET-21 b (+) vector was linearized by PCR using the high fidelity Phusion polymerase with primers FORWARD:tgtcgacggagctcgaattcg and REVERSE:ttaaagcttgcggccgcactcg. Expected size of the amplicon was 5442 bp.
Amplification product sizes were checked on EtBr stained agarose gel (Figure 1).
Amplification products matched the expected size, they were further purified from gel.
The Gal d 2-OmpA construction was then inserted into pET-21 b (+) by In-Fusion. The resulting products were transformed into Stellar competent cells. Transformants were selected on LB-ampicillin plates. 20 transformants were screened by colony PCR with primer pairs flanking the insertion zone ( FORWARD: ggttatgctagttattgctcagc and REVERSE: ccgaaacaagcgctcatgagc, expected size of the amplicon : 2092 bp). 2 positive transformants were detected (Figure 3).
These transformants had their plasmid extracted by Miniprep and digested by EcoRV to assess the assembly (expected fragments at 4332 bp and 2785 bp, see Figure 4).
The correct restriction maps were obtained and the insert sequence was further validated by sequencing. The plasmid was named pET-21 b (+)_OmpA_Gal d 2. The plasmids were eventually used to transform E. coli Tuner cells in order to express the OmpA_Gal d 2 construction at the cell membrane.
After cloning this first allergen, the plasmid obtained was used as a basis to build the other allergen constructions of our bank: Ara h 2, Der p 1 and Ana o 3.
Xxxxxxxxx
Xxxxxxxxxxxxx
titre 2
Titre 3
Xxxxxxxxxx
titre 3
Titre 4
Xxxxxx
Titre 4
xxxxxxx
Titre 2
Xxxxxx
References
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12INCOMPATIBLE WITH RFC[12]Illegal NheI site found at 114
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000INCOMPATIBLE WITH RFC[1000]Illegal SapI.rc site found at 325