Difference between revisions of "Part:BBa K4197018"

Revision as of 13:31, 5 October 2022

Gene coding for Gal d 2

Gene coding for the egg allergen called Gal d 2.

Introduction

Xxxxx xxxxx xxxxx xxxxxx xxxx

Construction

OmpA_Gal d 2 fragment from IDT gblock was amplified by PCR using the high fidelity Phusion polymerase with primers IF3_allergen-F and IF4_Gal D2/DARPin-R. Expected size of the amplicon was 1675 bp.

pET-21 b (+) vector was linearized by PCR using the high fidelity Phusion polymerase with primers IF1_GalD2/DARPin-F and IF2_plasmid-R. Expected size of the amplicon was 5442 bp.

Amplification product sizes were checked on EtBr stained agarose gel (Figure 1).

Figure 1: pET-21 b (+) linearized (A) and Gal d 2 amplified fragment (B). Expected sizes of the amplicons were 5442 bp (A) and 1675 bp (B). PCR amplicon sizes of pET-21 b (+) (A) and Gal d 2 (B) were checked with agarose electrophoresis gel and revealed with EtBr. A theoretical gel is presented with each gel and the NEB 1 kb DNA ladder is used for the experimental gels. (note that a different ladder is presented on the theoretical gel).

Amplification products matched the expected size, they were further purified from gel.

The Gal d 2-OmpA construction was then inserted into pET-21 b (+) by In-Fusion. The resulting products were transformed into Stellar competent cells. Transformants were selected on LB-ampicillin plates. 20 transformants were screened by colony PCR with primer pairs flanking the insertion zone ( screening_inserts-F and screening_inserts-R, expected size of the amplicon : 2092 bp) (see Primers List). 2 positive transformants were detected (Figure 3).

Figure 2: identifying fragments that bear pET21 b (+)_Ompa_Gal d 2 by colony PCR. Expected size of the amplicon was 2092 bp. The positive clones were colonies 17 and 24. PCR amplicon sizes of colonies with Gal d 2 plasmid were checked with agarose electrophoresis gel and revealed with EtBr. A theoretical gel is presented with each gel and the NEB 1 kb DNA ladder is used for the experimental gels (note that a different ladder is presented on the theoretical gel).

These transformants had their plasmid extracted by Miniprep and digested by EcoRV to assess the assembly (expected fragments at 4332 bp and 2785 bp, see Figure 4).

Figure 3: restriction profile of pET-21 b (+)_OmpA_Gal d 2 final construction. Enzyme used was EcoRV. Expected sizes of the amplicons were 4332 bp and 2785 bp. Plasmids were checked with agarose electrophoresis gel and revealed with EtBr. A theoretical gel is presented with each gel and the NEB 1 kb DNA ladder is used for the experimental gels (note that a different ladder is presented on the theoretical gel).

The correct restriction maps were obtained and the insert sequence was further validated by sequencing. The plasmid was named pET-21 b (+)_OmpA_Gal d 2. The plasmids were eventually used to transform E. coli Tuner cells in order to express the OmpA_Gal d 2 construction at the cell membrane.

After cloning this first allergen, the plasmid obtained was used as a basis to build the other allergen constructions of our bank: Ara h 2, Der p 1 and Ana o 3.

Figure 1: Xxxxxx Xxxxxxxxxxxxxxxxxxxxxxxxxxx.

Xxxxxxxxx

Xxxxxxxxxxxxx

Figure 2: Xxxxxxxxxxxxx Xxxxxxxxxxxxx.

titre 2

Titre 3

Xxxxxxxxxx

• Forward : TAAGAAGGAGATATACCATGGCGGAAGCGGGTATCACC
• Reverse : CTCGAGTGCGGCCGCAAGCTTCGGATCGTCCTATGATGGAGG

Xxxxxxxxxx

• CForward : CGCGGCCGCTTCTAGAGCGGAAGCGGGTATCACC
• Reverse : AGCGGCCGCTACTAGTCGGATCGTCCTATGATGGAGG

titre 3

Titre 4

Xxxxxx

Titre 4

xxxxxxx

Titre 2

Xxxxxx

References

1. Morag E, Lapidot A, Govorko D, Lamed R, Wilchek M, Bayer EA, Shoham Y: Expression, purification, and characterization of the cellulose-binding domain of the scaffoldin subunit from the cellulosome of Clostridium thermocellum. Applied and Environmental Microbiology 1995, 61:1980-1986.
2. Nogueira ES, Schleier T, Durrenberger M, Ballmer-Hofer K, Ward TR, Jaussi R: High-level secretion of recombinant full-length streptavidin in Pichia pastoris and its application to enantioselective catalysis. Protein Expr Purif 2014, 93:54-62. DOI: 10.1016/j.pep.2013.10.015.
3. Young TS, Schultz PG: Beyond the canonical 20 amino acids: expanding the genetic lexicon. J Biol Chem 2010, 285:11039-11044. DOI: 10.1074/jbc.R109.091306.

Sequence and Features