Difference between revisions of "Part:BBa K4425000"
(One intermediate revision by the same user not shown) | |||
Line 5: | Line 5: | ||
Trp repressor adopt a conformation change that amino acid 66-86 into a stable HTH motif which allow the repressor | Trp repressor adopt a conformation change that amino acid 66-86 into a stable HTH motif which allow the repressor | ||
to interact with the operator with high affinity. Downstream gene expression is suppressed when trp repressor bind | to interact with the operator with high affinity. Downstream gene expression is suppressed when trp repressor bind | ||
− | operator | + | operator. |
+ | |||
+ | |||
+ | ==Usage and Biology== | ||
+ | This is a mutant that is mutated by a wild-type tryptophan repressor that can bind to mutant trp operator mutant O1 | ||
+ | (GATGTAGTTAACTACAACGCA) with high affinity. Both trp and Br-trp are valid ligand to the trp repressor with a little difference in affinity (Fig. 1). | ||
+ | [[Image:25000-1.png|400px|thumbnail|center|'''Figure 1:''' the trp repressor was tested in the presense of trp or Br-trp (1mM), and maxmal promoter expression was measured]] | ||
+ | |||
+ | ==Source== | ||
+ | generate by Ellefson et al, 2018 | ||
+ | |||
+ | ==Characterization== | ||
+ | We construct pTrpR to express trp repressor and co-transform pTrpR with pNEG into DH5α. We tested the RPU/OD600 which stand for promoter expression of the induced cell, under the condition of different concentration of Trp. However, it can only provide about three times the inhibition effect in promoter expression. | ||
+ | [[Image:25000-3.png|400px|thumbnail|center|'''Figure 2:''' schemtic of pTrpR and pNEG]] | ||
+ | [[Image:25000-2.jpeg|400px|thumbnail|center|'''Figure 3:''' GFP production (RPU/OD600) – trp concentration graph by GFP test for wild type trp repressor and pNEG.]] | ||
+ | |||
− | |||
− | |||
<!-- --> | <!-- --> | ||
Line 19: | Line 32: | ||
<partinfo>BBa_K4425000 parameters</partinfo> | <partinfo>BBa_K4425000 parameters</partinfo> | ||
<!-- --> | <!-- --> | ||
+ | |||
+ | ===Reference=== | ||
+ | Ellefson, J. W., Ledbetter, M. P., & Ellington, A. D. Directed evolution of a synthetic phylogeny of programmable Trp repressors. Nature chemical biology, 2018, 14(4), 361–367. |
Latest revision as of 08:39, 5 October 2022
Trp repressor
Trp repressor adopt a conformation change that amino acid 66-86 into a stable HTH motif which allow the repressor to interact with the operator with high affinity. Downstream gene expression is suppressed when trp repressor bind operator.
Usage and Biology
This is a mutant that is mutated by a wild-type tryptophan repressor that can bind to mutant trp operator mutant O1 (GATGTAGTTAACTACAACGCA) with high affinity. Both trp and Br-trp are valid ligand to the trp repressor with a little difference in affinity (Fig. 1).
Source
generate by Ellefson et al, 2018
Characterization
We construct pTrpR to express trp repressor and co-transform pTrpR with pNEG into DH5α. We tested the RPU/OD600 which stand for promoter expression of the induced cell, under the condition of different concentration of Trp. However, it can only provide about three times the inhibition effect in promoter expression.
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000INCOMPATIBLE WITH RFC[1000]Illegal SapI.rc site found at 315
Reference
Ellefson, J. W., Ledbetter, M. P., & Ellington, A. D. Directed evolution of a synthetic phylogeny of programmable Trp repressors. Nature chemical biology, 2018, 14(4), 361–367.