Difference between revisions of "Part:BBa K4425000"

Line 5: Line 5:
 
Trp repressor adopt a conformation change that amino acid 66-86 into a stable HTH motif which allow the repressor
 
Trp repressor adopt a conformation change that amino acid 66-86 into a stable HTH motif which allow the repressor
 
to interact with the operator with high affinity. Downstream gene expression is suppressed when trp repressor bind  
 
to interact with the operator with high affinity. Downstream gene expression is suppressed when trp repressor bind  
operator
+
operator.
 +
 
 +
 
 +
==Usage and Biology==
 +
This is a mutant that is mutated by a wild-type tryptophan repressor that can bind to mutant trp operator mutant O1
 +
(GATGTAGTTAACTACAACGCA) with high affinity. Both trp and Br-trp are valid ligand to the trp repressor with a little difference in affinity (Fig. 1).
 +
[[Image:25000-1.png|400px|thumbnail|center|'''Figure 1:''' the trp repressor was tested in the presense of trp or Br-trp (1mM), and maxmal promoter expression was measured]]
 +
 
 +
==Source==
 +
generate by Ellefson et al, 2018
 +
 
 +
==Characterization==
 +
We construct pTrpR to express trp repressor and co-transform pTrpR with pNEG into DH5α. We tested the RPU/OD600 which stand for promoter expression of the induced cell, under the condition of different concentration of Trp. However, it can only provide about three times the inhibition effect in promoter expression.
 +
[[Image:25000-3.png|400px|thumbnail|center|'''Figure 2:''' schemtic of pTrpR and pNEG]]
 +
[[Image:25000-2.jpeg|400px|thumbnail|center|'''Figure 3:''' GFP production (RPU/OD600) – trp concentration graph by GFP test for wild type trp repressor and pNEG (due to time and pandemic, we only completed the experiment of pNEG).]]
 +
 
  
<!-- Add more about the biology of this part here
 
===Usage and Biology===
 
  
 
<!-- -->
 
<!-- -->
Line 19: Line 32:
 
<partinfo>BBa_K4425000 parameters</partinfo>
 
<partinfo>BBa_K4425000 parameters</partinfo>
 
<!-- -->
 
<!-- -->
 +
 +
===Reference===
 +
Ellefson, J. W., Ledbetter, M. P., & Ellington, A. D. Directed evolution of a synthetic phylogeny of programmable Trp repressors. Nature chemical biology, 2018, 14(4), 361–367.

Revision as of 08:39, 5 October 2022


Trp repressor

Trp repressor adopt a conformation change that amino acid 66-86 into a stable HTH motif which allow the repressor to interact with the operator with high affinity. Downstream gene expression is suppressed when trp repressor bind operator.


Usage and Biology

This is a mutant that is mutated by a wild-type tryptophan repressor that can bind to mutant trp operator mutant O1 (GATGTAGTTAACTACAACGCA) with high affinity. Both trp and Br-trp are valid ligand to the trp repressor with a little difference in affinity (Fig. 1).

Figure 1: the trp repressor was tested in the presense of trp or Br-trp (1mM), and maxmal promoter expression was measured

Source

generate by Ellefson et al, 2018

Characterization

We construct pTrpR to express trp repressor and co-transform pTrpR with pNEG into DH5α. We tested the RPU/OD600 which stand for promoter expression of the induced cell, under the condition of different concentration of Trp. However, it can only provide about three times the inhibition effect in promoter expression.

Figure 2: schemtic of pTrpR and pNEG
Figure 3: GFP production (RPU/OD600) – trp concentration graph by GFP test for wild type trp repressor and pNEG (due to time and pandemic, we only completed the experiment of pNEG).


Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Illegal SapI.rc site found at 315


Reference

Ellefson, J. W., Ledbetter, M. P., & Ellington, A. D. Directed evolution of a synthetic phylogeny of programmable Trp repressors. Nature chemical biology, 2018, 14(4), 361–367.