|
|
(One intermediate revision by one other user not shown) |
Line 1: |
Line 1: |
− | | + | <html lang="en"> |
− | __NOTOC__
| + | <head> |
− | <partinfo>BBa_K4263007 short</partinfo> | + | <meta charset="UTF-8"> |
− | | + | <meta http-equiv="X-UA-Compatible" content="IE=edge"> |
− | AACATCCAAAGACGAAAGGTTGAATGAAACCTTTTTGCCATCCGACATCCACAGGTCCATTCTCACACATAAGTGCCAAACGCAACAGGAGGGGATACACTAGCAGCAGACCGTTGCAAACGCAGGACCTCCACTCCTCTTCTCCTCAACACCCACTTTTGCCATCGAAAAACCAGCCCAGTTATTGGGCTTGATTGGAGCTCGCTCATTCCAATTCCTTCTATTAGGCTACTAACACCATGACTTTATTAGCCTGTCTATCCTGGCCCCCCTGGCGAGGTTCATGTTTGTTTATTTCCGAATGCAACAAGCTCCGCATTACACCCGAACATCACTCCAGATGAGGGCTTTCTGAGTGTGGGGTCAAATAGTTTCATGTTCCCCAAATGGCCCAAAACTGACAGTTTAAACGCTGTCTTGGAACCTAATATGACAAAAGCGTGATCTCATCCAAGATGAACTAAGTTTGGTTCGTTGAAATGCTAACGGCCAGTTGGTCAAAAAGAAACTTCCAAAAGTCGGCATACCGTTTGTCTTGTTTGGTATTGATTGACGAATGCTCAAAAATAATCTCATTAATGCTTAGCGCAGTCTCTCTATCGCTTCTGAACCCCGGTGCACCTGTGCCGAAACGCAAATGGGGAAACACCCGCTTTTTGGATGATTATGCATTGTCTCCACATTGTATGCTTCCAAGATTCTGGTGGGAATACTGCTGATAGCCTAACGTTCATGATCAAAATTTAACTGTTCTAACCCCTACTTGACAGCAATATATAAACAGAAGGAAGCTGCCCTGTCTTAAACCTTTTTTTTTATCATCATTATTAGCTTACTTTCATAATTGCGACTGGTTCCAATTGACAAGCTTTTGATTTTAACGACTTTTAACGACAACTTGAGAAGATCAAAAAACAACTAATTATTCGAAACG
| + | <meta name="viewport" content="width=device-width, initial-scale=1.0"> |
− | | + | <title>K4263007</title> |
− | <!-- Add more about the biology of this part here | + | <link rel="stylesheet" href="https://2022.igem.wiki/scut-china/static/css/part-public.css"> |
− | ===Usage and Biology=== | + | </head> |
− | | + | <body> |
− | <!-- --> | + | <article> |
| + | <h2 style="font-weight: bold;">P<sub>AOX1</sub></h2> |
| + | <h2>Introduction</h2> |
| + | <p>AOX1 promoter is a key promoter in the methylotrophic yeast <em>Pichia pastoris</em>.</p> |
| + | <h2>Characterization</h2> |
| + | <p>In order to test the function of P<em><sub>AOX1</sub></em>, we construct "P<em><sub>AOX1</sub>-EGFP</em>-terminator" (Figure 1). If P<em><sub>AOX1</sub></em> is functional, we can test the fluorescence intensity of EGFP in supernatant samples obtained from the culture of recombinant <em>P.pastoris</em> GS115 strain.</p> |
| + | <img src="https://static.igem.wiki/teams/4263/wiki/parts/image/aox1e-min.jpg" alt=""> |
| + | <h4>Figure 1 Gene circuit of P<em><sub>AOX1</sub>-EGFP</em>-terminator</h4> |
| + | <p>Our results matched the general expected trend (Figure 2). After fermentation experiment in BMMY medium containing 1% methanol. The fluorescence intensity of the samples of recombinant <em>P.pastoris</em> GS115 containing the <em>EGFP</em> gene gradually increased over time, which is in line with literature description<sup>[1]</sup>. At the same time, we measured the growth curve of the strains.</p> |
| + | <img src="https://static.igem.wiki/teams/4263/wiki/parts/image/paox1-min.jpg" alt=""> |
| + | <h4>Figure 2 Fluorescence intensity and OD600 absorbance of samples obtained at different time points from the culture of corresponding recombinant <em>P.pastoris</em> GS115 containing <em>EGFP</em> gene.</h4> |
| + | <h2>Reference</h2> |
| + | <p>[1] Xuan Y, Zhou X, Zhang W, et al. An upstream activation sequence controls the expression of <em>AOX1</em> gene in Pichia pastoris[J]. FEMS Yeast Res, 2009,9(8):1271-1282.</p> |
| + | </article> |
| + | </body> |
| + | </html> |
| + | <!-- --> |
| <span class='h3bb'>Sequence and Features</span> | | <span class='h3bb'>Sequence and Features</span> |
| <partinfo>BBa_K4263007 SequenceAndFeatures</partinfo> | | <partinfo>BBa_K4263007 SequenceAndFeatures</partinfo> |
| + | |
| | | |
| | | |
Line 16: |
Line 33: |
| ===Functional Parameters=== | | ===Functional Parameters=== |
| <partinfo>BBa_K4263007 parameters</partinfo> | | <partinfo>BBa_K4263007 parameters</partinfo> |
− | <!-- -->
| |
PAOX1
Introduction
AOX1 promoter is a key promoter in the methylotrophic yeast Pichia pastoris.
Characterization
In order to test the function of PAOX1, we construct "PAOX1-EGFP-terminator" (Figure 1). If PAOX1 is functional, we can test the fluorescence intensity of EGFP in supernatant samples obtained from the culture of recombinant P.pastoris GS115 strain.
Figure 1 Gene circuit of PAOX1-EGFP-terminator
Our results matched the general expected trend (Figure 2). After fermentation experiment in BMMY medium containing 1% methanol. The fluorescence intensity of the samples of recombinant P.pastoris GS115 containing the EGFP gene gradually increased over time, which is in line with literature description[1]. At the same time, we measured the growth curve of the strains.
Figure 2 Fluorescence intensity and OD600 absorbance of samples obtained at different time points from the culture of corresponding recombinant P.pastoris GS115 containing EGFP gene.
Reference
[1] Xuan Y, Zhou X, Zhang W, et al. An upstream activation sequence controls the expression of AOX1 gene in Pichia pastoris[J]. FEMS Yeast Res, 2009,9(8):1271-1282.