Difference between revisions of "Part:BBa K3883031"

Latest revision as of 21:15, 26 September 2022

targeted knockdown the expression of gltA gene through CRISPRi

This part targeted knockdown the expression of gltA gene through CRISPRi to downregulate TCA cycle.By qRT-PCR, the inhibitory effect of CRISPRi system on gltA gene is verified.

Usage and Biology

Fig. 1 The pathway of pT7-dCas9-sgRNA.

The introduction of mutations in the nuclease domain of Cas9 from Streptococcus pyogenes produces nuclease defects, turning Cas9 into dCas9 protein which is deficient in nucleic acid cutting activity. But it can still target and bind certain DNA with the same precision under the guidance of the corresponding RNA. Artificial synthesis of sgRNA2(BBa_K3883005) includes a pairing region binding to gene gltA and a Cas9 handle region interacting with dCas9, so that dCas9-sgRNA2 complex can bind to target DNA elements and cause spatial block to prevent transcription extension of RNA polymerase, resulting in precise site-specific regulation of gene gltA without causing DNA damage. Citrate synthase is a key enzyme in the tricarboxylic acid cycle. Inhibition of GltA gene encoding this enzyme through this part can effectively inhibit the tricarboxylic acid cycle, thus reducing the metabolic shunt of acetyl-CoA and making acetyl-CoA flow to the pathway of acetic acid synthesis to the maximum extent.For more information, please visit our Design page: Jilin_China 2021 Design

BS_United China utilized this parts to decrease the level of Bifunctional BirA enzyme which further increase the Biotin accumulation in the E. coli. This system insures the maximum yield of biotin. We have designed a sgRNA sequence (AAGTCACCATACGTTAGTAC) targeting the Bifunctional BirA enzyme after the production of biotin to prevent biotin from further disintegration.

Characterization

Characterizations of this part is in exactly the same way as BBa_K3883030.

Fig. 2 The sgRNA targeting PPCand gltA can reduce the corresponding mRNA level.(A) Primers designed for sgRNA-PPCand sgRNA-gltA. (B&C) Digestion and electrophoresis of two constructs. (D&E) The knockdown efficiency of sgRNA to PPC and gltA genes. The designed plasmid was transformed into E coli. BL21 and cultured until the value of OD600 reaches 0.4. After 8h IPTG induction, RNA extraction and reverse transcription were carried out. 16S rRNA was used as the reference gene and relative quantification was performed by qRT-PCR.

Sequence and Features