Difference between revisions of "Part:BBa K4235000:Design"

(→‎Design and cloning information)
(→‎References)
 
(3 intermediate revisions by the same user not shown)
Line 4: Line 4:
 
Ligation independent cloning is a technique alternative to traditional restriction enzyme cloning, which involves producing short homology arms/overhangs on the cloning substrates using PCR amplification. Vectors can be linearized using PCR primers or a restriction enzyme. For cloning into the pFastBac transfer vector, we used two primers (registry sequences) for linearizing the plasmid, which are attached to the 3’ and 5’ ends of the vector. Complementary primer sequences are used to amplify the insert for the cloning reaction. LIC exploits the dual polymerase - exonuclease activity of the T4 polymerase. The insert is treated with just dATPs and T4 polymerase, which chews back the 3’ ends until it reaches a T. Upon reaching a 3’ T, T4 polymerase gets stalled and switches its action to polymerase as it starts constantly adding dATP.  Similarly, the vector is treated with just dTTPs and T4 polymerase. This treatment step produces DNA constructs with 5’ overhangs that can anneal to one another in the final annealing reaction.  
 
Ligation independent cloning is a technique alternative to traditional restriction enzyme cloning, which involves producing short homology arms/overhangs on the cloning substrates using PCR amplification. Vectors can be linearized using PCR primers or a restriction enzyme. For cloning into the pFastBac transfer vector, we used two primers (registry sequences) for linearizing the plasmid, which are attached to the 3’ and 5’ ends of the vector. Complementary primer sequences are used to amplify the insert for the cloning reaction. LIC exploits the dual polymerase - exonuclease activity of the T4 polymerase. The insert is treated with just dATPs and T4 polymerase, which chews back the 3’ ends until it reaches a T. Upon reaching a 3’ T, T4 polymerase gets stalled and switches its action to polymerase as it starts constantly adding dATP.  Similarly, the vector is treated with just dTTPs and T4 polymerase. This treatment step produces DNA constructs with 5’ overhangs that can anneal to one another in the final annealing reaction.  
  
−
Primer design for LIC:
+
<h4>Primer design for LIC:</h4>
  
 
The following primers were used to PCR amplify the insert and the vector and to add the extra sequence designed for this particular LIC reaction.  
 
The following primers were used to PCR amplify the insert and the vector and to add the extra sequence designed for this particular LIC reaction.  
Line 13: Line 13:
 
Vector 5’ : CCGCCGCTGGA GGTTTCGGACCGAGATC
 
Vector 5’ : CCGCCGCTGGA GGTTTCGGACCGAGATC
 
Vector 3’ : GCTCCTCGGGCTCA GGTACCGATTACGATATCCC
 
Vector 3’ : GCTCCTCGGGCTCA GGTACCGATTACGATATCCC
 +
 +
===References:===
 +
 +
* U.S. National Library of Medicine. (n.d.). PROS1 protein S [homo sapiens (human)] - gene - NCBI. National Center for Biotechnology Information. Retrieved August 2, 2022, from https://www.ncbi.nlm.nih.gov/gene/5627 <br>
 +
 +
* U.S. National Library of Medicine. (n.d.). CCDS report for consensus cds. National Center for Biotechnology Information. Retrieved August 2, 2022, from https://www.ncbi.nlm.nih.gov/CCDS/CcdsBrowse.cgi?REQUEST=CCDS&GO=MainBrowse&DATA=CCDS2923.1 <br>
 +
 +
* Majumder, R., & Nguyen, T. (2021). Protein S: function, regulation, and clinical perspectives. Current opinion in hematology, 28(5), 339–344. https://doi.org/10.1097/MOH.0000000000000663 <br>
 +
 +
* Pilli, V. S., Plautz, W., & Majumder, R. (2016). The Journey of Protein S from an Anticoagulant to a Signaling Molecule. JSM biochemistry and molecular biology, 3(1), 1014. <br>

Latest revision as of 22:22, 22 September 2022

Design and cloning information

PROS1, the homo sapiens protein S gene, (NCBI:5627) is found on chromosome 3 and is known to exist in two major variants: the transcript variant 1 (NM_001314077.2) has an aligned length of 3,468 bp, the CDS length is 2,127 bp resulting in a 708 aa protein. The transcript variant 2 (NM_000313.4) has an aligned length of 3,372 bp, the CDS length is 2,031 bp resulting in a 676 aa protein. This part is designed from the 2,031 bp coding DNA sequence of the homo sapiens PROS1 gene, purposefully leaving out the 14 introns to streamline transcription and avoid undesired alternative splicing transcripts. The vertebrate Kozak sequence was also added to the 5’ end of the gene before synthesis.

Ligation independent cloning is a technique alternative to traditional restriction enzyme cloning, which involves producing short homology arms/overhangs on the cloning substrates using PCR amplification. Vectors can be linearized using PCR primers or a restriction enzyme. For cloning into the pFastBac transfer vector, we used two primers (registry sequences) for linearizing the plasmid, which are attached to the 3’ and 5’ ends of the vector. Complementary primer sequences are used to amplify the insert for the cloning reaction. LIC exploits the dual polymerase - exonuclease activity of the T4 polymerase. The insert is treated with just dATPs and T4 polymerase, which chews back the 3’ ends until it reaches a T. Upon reaching a 3’ T, T4 polymerase gets stalled and switches its action to polymerase as it starts constantly adding dATP. Similarly, the vector is treated with just dTTPs and T4 polymerase. This treatment step produces DNA constructs with 5’ overhangs that can anneal to one another in the final annealing reaction.

Primer design for LIC:

The following primers were used to PCR amplify the insert and the vector and to add the extra sequence designed for this particular LIC reaction.

Insert 5’ : CCAGCGGCGGT GCCACCATGAGGGTC Insert 3’ : GAGCCCGAGGAGCT AGAATTCTTTGTCTTTTTCCAAAC

Vector 5’ : CCGCCGCTGGA GGTTTCGGACCGAGATC Vector 3’ : GCTCCTCGGGCTCA GGTACCGATTACGATATCCC

References:

  • U.S. National Library of Medicine. (n.d.). PROS1 protein S [homo sapiens (human)] - gene - NCBI. National Center for Biotechnology Information. Retrieved August 2, 2022, from https://www.ncbi.nlm.nih.gov/gene/5627
  • Pilli, V. S., Plautz, W., & Majumder, R. (2016). The Journey of Protein S from an Anticoagulant to a Signaling Molecule. JSM biochemistry and molecular biology, 3(1), 1014.