Difference between revisions of "Part:BBa K3844003:Sequence, Features, and Subparts"
(→4. References) |
(→1. Function) |
||
Line 1: | Line 1: | ||
==1. Function== | ==1. Function== | ||
− | This is a transcription factor that binds to the Styrene VOC. It mainly regulates and represses the transcription of certain genes. | + | This is a transcription factor that binds to the Styrene VOC. It mainly regulates and represses the transcription of certain genes. |
==2. Design Consideration== | ==2. Design Consideration== |
Latest revision as of 03:44, 22 October 2021
1. Function
This is a transcription factor that binds to the Styrene VOC. It mainly regulates and represses the transcription of certain genes.
2. Design Consideration
Our project requires for the transcription factor to be dependent on the presence of VOCs. When researching the design of trimethylbenzene, the VOC that this transcription factor binds to, we needed to make sure that, hypothetically, everything would work based on our model. After checking through extensive research that our design would fit with this transcription factor, we chose it.
3. Chracterization
atggaagtgaacgcgggcggcgtgattgcgtatattagcagcagcagcagcgcgagcagc ccggcgagctgccatagcgaaggcagcgaaaacagctttcagagcagcagcagcagcgtg ccgagcagcccgaacagcagcaacagcgataccaacggcaacccgaaaaacggcgatctg gcgaacattgaaggcattctgaaaaacgatcgcattgattgcagcatgaaaaccagcaaa agcagcgcgccgggcatgaccaaaagccatagcggcgtgaccaaatttagcggcatggtg ctgctgtgcaaagtgtgcggcgatgtggcgagcggctttcattatggcgtgcatgcgtgc gaaggctgcaaaggcttttttcgccgcagcattcagcagaacattcagtataaaaaatgc ctgaaaaacgaaaactgcagcattatgcgcatgaaccgcaaccgctgccagcagtgccgc tttaaaaaatgcctgagcgtgggcatgagccgcgatgcggtgcgctttggccgcattccg aaacgcgaaaaacagcgcatgctgattgaaatgcagagcgcgatgaaaaccatgatgaac agccagtttagcggccatctgcagaacgataccctggtggaacatcatgaacagaccgcg ctgccggcgcaggaacagctgcgcccgaaaccgcagctggaacaggaaaacattaaaagc agcagcccgccgagcagcgattttgcgaaagaagaagtgattggcatggtgacccgcgcg cataaagatacctttatgtataaccaggaacagcaggaaaacagcgcggaaagcatgcag ccgcagcgcggcgaacgcattccgaaaaacatggaacagtataacctgaaccatgatcat tgcggcaacggcctgagcagccattttccgtgcagcgaaagccagcagcatctgaacggc cagtttaaaggccgcaacattatgcattatccgaacggccatgcgatttgcattgcgaac ggccattgcatgaactttagcaacgcgtatacccagcgcgtgtgcgatcgcgtgccgatt gatggctttagccagaacgaaaacaaaaacagctatctgtgcaacaccggcggccgcatg catctggtgtgcccgctgagcaaaagcccgtatgtggatccgcataaaagcggccatgaa atttgggaagaatttagcatgagctttaccccggcggtgaaagaagtggtggaatttgcg aaacgcattccgggctttcgcgatctgagccagcatgatcaggtgaacctgctgaaagcg ggcacctttgaagtgctgatggtgcgctttgcgagcctgtttgatgcgaaagaacgcacc gtgacctttctgagcggcaaaaaatatagcgtggatgatctgcatagcatgggcgcgggc gatctgctgaacagcatgtttgaatttagcgaaaaactgaacgcgctgcagctgagcgat gaagaaatgagcctgtttaccgcggtggtgctggtgagcgcggatcgcagcggcattgaa aacgtgaacagcgtggaagcgctgcaggaaaccctgattcgcgcgctgcgcaccctgatt atgaaaaaccatccgaacgaagcgagcatttttaccaaactgctgctgaaactgccggat Ctgcgcagcctgaacaacatgcatagcgaagaactgctggcgtttaaagtgcatccg
4. References
1. https://www.nature.com/articles/s41598-021-82202-7
Sequence and Features
- 10INCOMPATIBLE WITH RFC[10]Illegal PstI site found at 435
Illegal PstI site found at 619
Illegal PstI site found at 1486
Illegal PstI site found at 1582 - 12INCOMPATIBLE WITH RFC[12]Illegal PstI site found at 435
Illegal PstI site found at 619
Illegal PstI site found at 1486
Illegal PstI site found at 1582
Illegal NotI site found at 1130 - 21INCOMPATIBLE WITH RFC[21]Illegal BamHI site found at 1176
- 23INCOMPATIBLE WITH RFC[23]Illegal PstI site found at 435
Illegal PstI site found at 619
Illegal PstI site found at 1486
Illegal PstI site found at 1582 - 25INCOMPATIBLE WITH RFC[25]Illegal PstI site found at 435
Illegal PstI site found at 619
Illegal PstI site found at 1486
Illegal PstI site found at 1582
Illegal NgoMIV site found at 663 - 1000COMPATIBLE WITH RFC[1000]