Difference between revisions of "Part:BBa K3652001"
(→‎1. Usage)
 
(27 intermediate revisions by one other user not shown)
Line 2: Line 2:
 
<partinfo>BBa_K3652001 short</partinfo>
 
<partinfo>BBa_K3652001 short</partinfo>
 
<br><br>
 
<br><br>
−
This DNA oligo is the cDNA template (5’ GTCATCATCATCATCATCATAAAGTTCTCTTATGATGATGATGATGATGAC 3’) for the shRNA designed to bind to and degrade sFlt1-14 mRNA in human endothelial cells. It can be inserted between any restriction site(s) with the proper prefix and suffix. When coded, this cDNA produces a shRNA sequence that will be manipulated by the Dicer enzyme in humans to produce siRNA and form a RISC complex that can degrade the mRNA of protein sFlt1-14, which is overproduced in the placentas of preeclamptic patients, and preventing its overexpression [1]. The target site on the sFlt1-14 mRNA is at position 2603-2626.
+
This DNA oligo is the cDNA template (5’ gtcatcatcatcatcatcataaagttctcttatgatgatgatgatgatgac 3’) for the shRNA designed to bind to and degrade sFlt1-14 mRNA in human endothelial cells. It can be inserted between any restriction site(s) with the proper prefix and suffix. When coded, this cDNA produces a shRNA sequence that will be manipulated by the Dicer enzyme in humans to produce siRNA and form a RISC complex that can degrade the mRNA of protein sFlt1-14, which is overproduced in the placentas of preeclamptic patients, and preventing its overexpression [1]. The target site on the sFlt1-14 mRNA is at position 2181-2202.
  
 
<br>
 
<br>
Line 8: Line 8:
 
==1. Usage==
 
==1. Usage==
  
−
This shRNA sequence would be used to silence the expression of sFlt1-14 in the human placenta. It can be delivered in several different ways, including through a viral vector, transkingdom (E. coli/bacterial) deliver system, or via synthetic nanoparticles such as lipid packaging systems.  
+
This shRNA sequence would be used to silence the expression of sFlt1-14 in the human placenta. It can be delivered in several different ways, including through a viral vector, transkingdom (E. coli/bacterial) deliver system, or via synthetic nanoparticles such as lipid packaging systems.
  
 
==2. Biology==
 
==2. Biology==
Line 38: Line 38:
 
Loop:<br>
 
Loop:<br>
 
Loops of 5, 7 or 9 nt. are similarly effective in testing<br>  
 
Loops of 5, 7 or 9 nt. are similarly effective in testing<br>  
−
 
+
Loop used in this case was 9 nt UUCAAGAGA
  
 
{| class="wikitable"
 
{| class="wikitable"
Line 47: Line 47:
 
|-
 
|-
 
|Sequence
 
|Sequence
−
|[[File:T--SSHS-Shenzhen--3.png]]
+
|https://2020.igem.org/wiki/images/c/cc/T--DNHS_SanDiego_CA--siRNA.jpeg
 
|-
 
|-
 
|GC% total
 
|GC% total
Line 59: Line 59:
 
|-
 
|-
 
|Target site
 
|Target site
−
|2603-2648 after start codon
+
|2181-2202 after start codon
 
|}
 
|}
  
Line 79: Line 79:
 
3. Mix gently by pipetting up and down, followed by incubation at room temperature (25 ℃) for 1-2 hours.
 
3. Mix gently by pipetting up and down, followed by incubation at room temperature (25 ℃) for 1-2 hours.
  
−
After this, a gel electrophoresis would be needed to verify the transcription, and the resulting length should be 55 nucleotides, as that is the length of the annealed shRNA oligo template.  
+
After this, a gel electrophoresis would be needed to verify the transcription, and the resulting length should be 53 nucleotides, as that is the length of the annealed shRNA oligo template.  
  
  
−
[[File:T--SSHS-Shenzhen--80092.png|thumb|Fig. 2. Diagram illustrating the procedure of GLS-shRNA-1 in vitro transcription]]
+
===3.4 RNAi efficiency test===
  
−
<br>
+
To verify the success of the RNA degradation, the protein sFtl1-14 can be quantified through western blot and control and shRNA samples can be compared by measured protein levels. The sample of shRNA-treated cells should have lower levels of sFlt1-14 if the knockdown was effective. <br><br>
−
The integrity of ALR-shRNA-1 was identified through 3% agarose gel eletrophoresis (Fig. 3) Agarose gel electrophoresis showed that the ALR-shRNA-1 was successfully transcribed. Sharp bands of around 52 bases in length were detected on the gel, the size of the bands is correct.
+
  
−
[[File:T--SSHS-Shenzhen--80072.png|thumb|Fig 3. Detection of in vitro transcribed GLS-shRNA-1 by agarose gel (3%). The integrity of shRNA was identified through 3% agarose gel eletrophoresis (200 V, 30 min).]]
+
However, if the gel electrophoresis showed successful shRNA transcription, and the western blotting does not show evidence of successful RNAi treatment, a qRT-PCR analysis should be performed with controls and shRNA samples to measure relative levels of the RNA remaining in each sample type. Here, one could expect to see lower levels of the sFlt1-14 RNA in treated samples compared to control samples. This would imply that more time was needed for the protein knockdown, and this timing discrepancy can provide a rough indication of how long protein knockdown would take after RNAi is achieved in target cells. <br><br>
  
−
===3.4 RNAi efficiency test===
+
In the case that even RNA knockdown is not observed through the qRT-PCR, targeting a different section of the mRNA to prevent off-target binding which might be occurring, or introducing a combination of shRNAs to target multiple sites at once to increase binding probability, might be helpful. <br><br>
  
−
[[File:T--SSHS-Shenzhen--80094.png|thumb|Fig.4. Adult P. striolata and Brassica chinensis leaves were placed into the glass bottles for RNAi efficiency test. GLS-shRNA-1 sample has two repeats.]]
+
[[File:T--DNHS SanDiego CA--model 1.png|link=|thumb|left|shRNA-sFlt1-14 binding affinity model]]
  
−
To verify the success of the RNA degradation, the protein sFtl1-14 can be quantified through western blot and control and shRNA samples can be compared by measured protein levels. The sample of shRNA-treated cells should have lower levels of sFlt1-14 if the knockdown was effective. <br><br>
+
[[File:T--DNHS SanDiego CA--Plasmid.png|link=|thumb|right|Plasmid map of tet-pLKO-neo with the shRNA insert]]
  
−
However, if the gel electrophoresis showed successful shRNA transcription, and the western blotting does not show evidence of successful RNAi treatment, a qRT-PCR analysis should be performed with controls and shRNA samples to measure relative levels of the RNA remaining in each sample type. Here, one could expect to see lower levels of the sFlt1-14 RNA in treated samples compared to control samples. This would imply that more time was needed for the protein knockdown, and this timing discrepancy can provide a rough indication of how long protein knockdown would take after RNAi is achieved in target cells. <br><br>
+
[[File:T--DNHS SanDiego CA--Pathway.png|link=|thumb|right|Pathway to shRNA expression using the tet-pLKO-neo cloning plasmid]]
  
−
In the case that even RNA knockdown is not observed through the qRT-PCR, targeting a different section of the mRNA to prevent off-target binding which might be occurring, or introducing a combination of shRNAs to target multiple sites at once to increase binding probability, might be helpful.
+
 
 +
===3.5 Example Plasmid Insertion (tet-pLKO-neo)===
 +
As previously stated, one example of a vector that could be used for the delivery and expression of this shRNA is the lentiviral vector, with tet-on cloning plasmid tet-pLKO-neo. The operation with this system is shown in the diagrams to the right.
 +
 
 +
 
 +
 
 +
===3.6 Molecular Model===
 +
To the above left is the model of the binding of our chosen shRNA (Part BBa_K3652001) to the sFlt1-14 molecule we are targeting. This binding site shows the affinity, and the mRNA coding for that amino acid region of the protein is where we expect the molecule to be cleaved.
 +
 
 +
We used the Protein Data Bank in order to find the amino acid sequence of a sFLT-1 molecule, then used PYMOL to model the structure of the molecule.
  
  
−
[[File:T--SSHS-Shenzhen--7.png|thumb|Fig. 5 The survival rate of Phyllotreta striolata at different days after GLS-shRNA-1 treatment.]]
 
  
 
==4. References==
 
==4. References==
−
[1] Baum J.A., Bogaert T., Clinton W., Heck G.R., Feldmann P., Ilagen O., Johnson S., Plaetinck G., Munyikwa T., Pleau M., Vaughn T., Roberts J. 2007: Control of coleopteran insect pests through RNA interference. Nat. Biotech. 25: 1322–1326.<br>
+
[1] Roberts, J., & Rajakumar, A. (2009, July). Preeclampsia and soluble fms-like tyrosine kinase 1. Retrieved October 23, 2020, from https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2708948/<br>
−
[2] Gorden K.H. & Waterhouse P.M. 2007: RNAi for insect-proof plants. Nat. Biotech.25: 1231–1232.<br>
+
[2] Sela, S. (2007, December 30). Homo sapiens soluble VEGF receptor 1-14 (FLT1) mRNA, complete cds - Nucleotide - NCBI. Retrieved October 23, 2020, from https://www.ncbi.nlm.nih.gov/nuccore/EU368830.1?report=fasta<br>
−
[3] Macrae I.J., Zhou K., Li F., Repic A., Brooks A.N., Cande W.Z., Adams P.D., Doudna J.A. 2006: Structural basis for double-stranded RNA processing by Dicer. Science. 311 (5758): 195–8.<br>
+
[3] Find siRNA sequences - Standard search. (n.d.). Retrieved October 23, 2020, from https://www.invivogen.com/sirnawizard/design.php<br>
−
[4] Mao Y.B., CAI W.J., WANG J.W., HONG G.J., TAO X.Y., WANG L.J., HUANG Y.P., CHEN X.Y. 2007: Silencing a cotton bollworm P450 monooxygenase gene by plant-mediated RNAi impairs larval tolerance of gossypol. Nat. Biotech. 25: 1307–1313.<br>
+
[4] (n.d.). Retrieved October 23, 2020, from https://horizondiscovery.com/en/products/tools/siDESIGN-Center
−
[5] Turner C.T., Davy M.W., Macdiarmid R.M., Plummer K.M., Birch N.P., Newcomb R.D. 2006: RNA interference in the light brown apple moth, Epiphyas postvittana (Walker) induced by double-stranded RNA feeding. Insect Mol. Biol. 15: 383–391.<br>
+
[5] GenScript siRNA Target Finder. (n.d.). Retrieved October 23, 2020, from https://www.genscript.com/tools/sirna-target-finder<br>
−
[6] Wang M, Weiberg A, Lin F M, et al. Bidirectional cross-kingdom RNAi and fungal uptake of external RNAs confer plant protection[J]. Nature Plants, 2016, 2(10):16151-16151.<br>
+
[6] (n.d.). Retrieved October 23, 2020, from https://rnaidesigner.thermofisher.com/rnaiexpress/<br>
−
[7] Zhao Y.Y., Yang G., Pruski W., You M.S. 2008: Phyllotreta striolata (Coleoptera: Chrysomelidae): arginine kinase cloning and RNAi-based pest control. Eur J Entomol 105: 815–822.
+
[7] Kay Lab siRNA/shRNA/Oligo Optimal Design. (n.d.). Retrieved October 23, 2020, from http://web.stanford.edu/group/markkaylab/cgi-bin/<br>
 +
[8] SiRNA and shRNA Design Guidelines. (2019, November 26). Retrieved October 23, 2020, from https://www.invivogen.com/review-sirna-shrna-design<br>
 +
[9] Li, L., Lin, X., Khvorova, A., Fesik, S., & Shen, Y. (2013, October). Defining the optimal parameters for hairpin-based knockdown constructs. Retrieved October 23, 2020, from https://www.ncbi.nlm.nih.gov/pmc/articles/PMC1986814/
 +
 
 
<!-- -->
 
<!-- -->
 
<span class='h3bb'>Sequence and Features</span>
 
<span class='h3bb'>Sequence and Features</span>
−
<partinfo>BBa_K2878003 SequenceAndFeatures</partinfo>
+
<partinfo>BBa_K3652001 SequenceAndFeatures</partinfo>

Latest revision as of 02:07, 22 October 2021

sFlt1-14 shRNA (pLKO-tet-neo)

This DNA oligo is the cDNA template (5’ gtcatcatcatcatcatcataaagttctcttatgatgatgatgatgatgac 3’) for the shRNA designed to bind to and degrade sFlt1-14 mRNA in human endothelial cells. It can be inserted between any restriction site(s) with the proper prefix and suffix. When coded, this cDNA produces a shRNA sequence that will be manipulated by the Dicer enzyme in humans to produce siRNA and form a RISC complex that can degrade the mRNA of protein sFlt1-14, which is overproduced in the placentas of preeclamptic patients, and preventing its overexpression [1]. The target site on the sFlt1-14 mRNA is at position 2181-2202.


1. Usage

This shRNA sequence would be used to silence the expression of sFlt1-14 in the human placenta. It can be delivered in several different ways, including through a viral vector, transkingdom (E. coli/bacterial) deliver system, or via synthetic nanoparticles such as lipid packaging systems.

2. Biology

Eukaryotic organisms contain an RNAi mechanism for sequence-specific gene silencing that is triggered by the introduction of double-stranded RNA (dsRNA). Once introduced into the cell, the dsRNA or shRNA is cleaved into small interfering RNA (siRNA) by an enzyme called Dicer, producing two siRNAs, a sense strand, and an antisense strand. Each siRNA strand is loaded into Argonaute, an endonuclease, to form an RNA-induced Silencing Complex (RISC), and guiding the RISC to the target mRNA, resulting in the effective cleavage and subsequent degradation of the target mRNA. RNAi mechanisms can be triggered by introducing dsRNA, siRNA or shRNA, and sometimes miRNA as well.


3. Characterization

3.1 Design of GLS-shRNA-1

This part was synthesized as a shRNA (small hairpin RNA) sequence for the mRNA sequence of sFlt1-14 [2], a protein that plays a major role in the molecular mechanisms of preeclampsia [1]. sFlt1-14 (soluble Fms-like tyrosine kinase 1-14) is an antiangiogenic receptor that binds with PlGF (Placental Growth Factor) and VEGF (Vascular Endothelial Growth Factor), preventing them from binding to their proper receptors that signal for angiogenesis in the placenta. This shRNA cDNA can be expressed in any vector that is safe to use in vivo for human/mammalian RNAi (RNA interference).

The shRNA was developed as a region complementary to the mRNA of the sFlt1-14, and with several other parameters in mind, described below in design considerations.

This novel part was synthesized using siRNA design software, corroborated from several sources including the InvivoGen siRNA wizard [3], the Horizon Discovery siDESIGN tool [4], the GenScript siRNA Design Center [5], the Stanford Design Center [6], and the Thermo Fischer BLOCK-iT™ RNAi Designer software [7].

After cross-checking various siRNA recommended by the InvivoGen, Horizon, GenScript, Stanford Design, and Thermo Fisher software algorithms, the following general shRNA design guidelines from InvivoGen [8] were taken into consideration to attain this specific shRNA sequence:

Target site:
Not being in the first 100 bases from the start codon or within 100 bases from the stop codon
Not being in the intron

Nucleotide content of siRNA:
The first nucleotide of the siRNA coding sequence can either be an A or a G
(Generally A, but can be G if using an H1 promoter)
GC content of ~35-50% GC content
UU overhangs in 3′-end (increase siRNA stability)
siRNA should be < 30 nt to avoid nonspecific silencing

Loop:
Loops of 5, 7 or 9 nt. are similarly effective in testing
Loop used in this case was 9 nt UUCAAGAGA

Table 1. Characteristics of sFlt1-14 shRNA 1
shRNA sFlt1-14 shRNA 1
Sequence T--DNHS_SanDiego_CA--siRNA.jpeg
GC% total 31.5
GC% at 5′-end of shRNA strand (sense siRNA) 33
GC% at 3′-end of shRNA strand (antisense siRNA) 30
Target site 2181-2202 after start codon

3.2 shRNA Subcloning

Resuspend each target oligonucleotide in ddH2O to a concentration of 100 µM.
Mix the sense and antisense oligos at a 1:1 ratio, resulting in 50 µM of ds oligo (assuming 100% annealing efficiency).
1. Using a PCR thermocycler, perform oligo annealing at:

72 ℃ for 2 minutes
37 ℃ for 2 minutes
25 ℃ for 2 minutes

2. Set up the ligation reaction:

Bbs I linearized vector at 4 µl
Annealed oligonucleotides at 3 µl
5x DNA Ligase Buffer at 2 µl
T4 DNA Ligase at 1 µl
Total volume should be 10 µl

3. Mix gently by pipetting up and down, followed by incubation at room temperature (25 ℃) for 1-2 hours.

After this, a gel electrophoresis would be needed to verify the transcription, and the resulting length should be 53 nucleotides, as that is the length of the annealed shRNA oligo template.


3.4 RNAi efficiency test

To verify the success of the RNA degradation, the protein sFtl1-14 can be quantified through western blot and control and shRNA samples can be compared by measured protein levels. The sample of shRNA-treated cells should have lower levels of sFlt1-14 if the knockdown was effective.

However, if the gel electrophoresis showed successful shRNA transcription, and the western blotting does not show evidence of successful RNAi treatment, a qRT-PCR analysis should be performed with controls and shRNA samples to measure relative levels of the RNA remaining in each sample type. Here, one could expect to see lower levels of the sFlt1-14 RNA in treated samples compared to control samples. This would imply that more time was needed for the protein knockdown, and this timing discrepancy can provide a rough indication of how long protein knockdown would take after RNAi is achieved in target cells.

In the case that even RNA knockdown is not observed through the qRT-PCR, targeting a different section of the mRNA to prevent off-target binding which might be occurring, or introducing a combination of shRNAs to target multiple sites at once to increase binding probability, might be helpful.

shRNA-sFlt1-14 binding affinity model
Plasmid map of tet-pLKO-neo with the shRNA insert
Pathway to shRNA expression using the tet-pLKO-neo cloning plasmid


3.5 Example Plasmid Insertion (tet-pLKO-neo)

As previously stated, one example of a vector that could be used for the delivery and expression of this shRNA is the lentiviral vector, with tet-on cloning plasmid tet-pLKO-neo. The operation with this system is shown in the diagrams to the right.


3.6 Molecular Model

To the above left is the model of the binding of our chosen shRNA (Part BBa_K3652001) to the sFlt1-14 molecule we are targeting. This binding site shows the affinity, and the mRNA coding for that amino acid region of the protein is where we expect the molecule to be cleaved.

We used the Protein Data Bank in order to find the amino acid sequence of a sFLT-1 molecule, then used PYMOL to model the structure of the molecule.


4. References

[1] Roberts, J., & Rajakumar, A. (2009, July). Preeclampsia and soluble fms-like tyrosine kinase 1. Retrieved October 23, 2020, from https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2708948/
[2] Sela, S. (2007, December 30). Homo sapiens soluble VEGF receptor 1-14 (FLT1) mRNA, complete cds - Nucleotide - NCBI. Retrieved October 23, 2020, from https://www.ncbi.nlm.nih.gov/nuccore/EU368830.1?report=fasta
[3] Find siRNA sequences - Standard search. (n.d.). Retrieved October 23, 2020, from https://www.invivogen.com/sirnawizard/design.php
[4] (n.d.). Retrieved October 23, 2020, from https://horizondiscovery.com/en/products/tools/siDESIGN-Center [5] GenScript siRNA Target Finder. (n.d.). Retrieved October 23, 2020, from https://www.genscript.com/tools/sirna-target-finder
[6] (n.d.). Retrieved October 23, 2020, from https://rnaidesigner.thermofisher.com/rnaiexpress/
[7] Kay Lab siRNA/shRNA/Oligo Optimal Design. (n.d.). Retrieved October 23, 2020, from http://web.stanford.edu/group/markkaylab/cgi-bin/
[8] SiRNA and shRNA Design Guidelines. (2019, November 26). Retrieved October 23, 2020, from https://www.invivogen.com/review-sirna-shrna-design
[9] Li, L., Lin, X., Khvorova, A., Fesik, S., & Shen, Y. (2013, October). Defining the optimal parameters for hairpin-based knockdown constructs. Retrieved October 23, 2020, from https://www.ncbi.nlm.nih.gov/pmc/articles/PMC1986814/

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]