Difference between revisions of "Part:BBa K3799003"

(→‎Pretreatment)
 
(19 intermediate revisions by 3 users not shown)
Line 3: Line 3:
 
<partinfo>BBa_K3799003 short</partinfo>
 
<partinfo>BBa_K3799003 short</partinfo>
  
−
This part is used produce Bovine pancreatic DNaseI(BBa_K3799002) under IPTG inducible Ecoli promoter(ROO10) aalong with RBS(B0034) and double terminator(B0015)
+
This part is used produce Bovine pancreatic DNaseI([https://parts.igem.org/Part:BBa_K3799002 BBa_K3799002]) under IPTG inducible Ecoli promoter([https://parts.igem.org/Part:BBa_R0010 BBa_R0010]) aalong with RBS([https://parts.igem.org/Part:BBa_B0034 BBa_B0034]) and double terminator([https://parts.igem.org/Part:BBa_B0015 BBa_B0015])
  
 
===Usage and Biology===
 
===Usage and Biology===
Line 25: Line 25:
 
===Cloning and expression===
 
===Cloning and expression===
  
−
The coding sequence for DNaseI was initially found from NCBI and then procured synthetically adding biobrick prefix and suffix from TwistBioscience.Cloning was carried out following Normal biobrick assembly using combination of EcoRI and PstI.Linearized plasmid back bone of PSBIC3 obtained by PCR amplification using Plasmid specific primers and Gene fragment were digested with EcoRI and PstI and further ligated .The resultant plasmid was transformed into Ecoli DH5α.Transformed colonies were identified and further confirmed using colony PCR and insert release check.
+
The coding sequence for DNaseI was initially found from NCBI and then procured synthetically adding biobrick prefix and suffix from TwistBioscience.Cloning was carried out following Normal biobrick assembly using combination of EcoRI and PstI.Linearized plasmid back bone of PSBIC3 obtained by PCR amplification using Plasmid specific primers and Gene fragment were digested with EcoRI and PstI and further ligated .The resultant plasmid was transformed into Ecoli DH5α.Transformed colonies were identified and further confirmed using colony PCR.
  
−
Primers used
+
[[Image:IISER_Kolkata--cPCR-DNASE_COMP.jpeg | thumb | center | 800 px |Colony PCR result of DnaseI composite part succesful.An estimated size of 1512 bp determined using Snapgene insilico PCR]]
 +
 
 +
=====Primers used=====
  
 
Biobrick Forward- gatggaattcgcggccgcttctag,
 
Biobrick Forward- gatggaattcgcggccgcttctag,
Line 43: Line 45:
  
 
We determined the activity of DNaseI on biofilm of Pseudomonas aeruginosa using 96 well plate biofilm assay.We did the assay at two different stages to determine the optimum concentration and time required for maximum degradation rate of bacterial biofilm.
 
We determined the activity of DNaseI on biofilm of Pseudomonas aeruginosa using 96 well plate biofilm assay.We did the assay at two different stages to determine the optimum concentration and time required for maximum degradation rate of bacterial biofilm.
 +
 +
  
 
====Pretreatment of bacterial biofilm with DNaseI====
 
====Pretreatment of bacterial biofilm with DNaseI====
  
−
Pretreatment was done to determine the optimum concentration of DNaseI  which gives maximum degradation of Pseudomonas biofilm.Bacterial biofilm was grown in 96 well plates in medium containing DNaseI supplemented at different concentration ranging from 0-25 µg/ml.Biofilm was quantified by checking absorbance at 595 nm after Crystal violet staining.Biofilm degradation rate was compared by calculating biofilm percentage reduction which is given by  
+
Pretreatment was done to determine the optimum concentration of DNaseI  which gives maximum degradation of Pseudomonas biofilm.Bacterial biofilm was grown in 96 well plates in medium containing DNaseI supplemented at different concentration ranging from 0-25 µg/ml for 72 hours.Biofilm was quantified by checking absorbance at 595 nm after Crystal violet staining.Biofilm degradation rate was compared by calculating biofilm percentage reduction which is given by  
 +
 
 +
[[Image:BBa K3799002--equation.jpeg | thumb | center | 800 px |]]
 +
 
 +
 
 +
 
 +
 
 +
[[Image:BBa_K3799003--pre.jpeg | thumb | center | 800 px |Biofilm percentage reduction under varying concentration of DNaseI ]]
 +
 
 +
It was observed that at a concentration of 10 µg/ml gave maximum BPR.BPR didnt further increase with higher concentrations.This concentration was taken as a standard for further experiments.
 +
 
 +
====Posttreatment of bacterial biofilm with DNaseI====
 +
 
 +
Posttreatment was done to determine the optimum incubation time of DNaseI to get maximum degradation.Bacterial biofilm was grown in 96 well plates for 72 hours to get maximum yield.Following this,bacterial colonies were washed off and the pure biofilm in wells were treated with DNaseI supplemented in media at a concentration of 10 µg/ml.Different wells were incubated for time points ranging from 0-50 min.Biofilm yield per condition was quantified by measuring absorbance at 595 nm after crystal violet treatment.Biofilm percentage reduction was further determined to compare degradation rate at different time point.
  
−
It was observed that at a concentration of 10 µg/ml gave maximum BPR.BPR didnt further increase with higher concentrations.
+
[[Image:BBa_K3799003--post.jpeg | thumb | center | 800 px |Biofilm percentage reduction by DNaseI for different incubation time ]]
  
−
[[Image:BBa_K3799003--pre.jpeg | thumb | center | 800 px | ]]
+
Wells incubated for 40 min showed maximum biofilm degradation.

Latest revision as of 00:21, 22 October 2021


Dnase I with promoter(R0010) , RBS(B0034), Terminator(B0015)

This part is used produce Bovine pancreatic DNaseI(BBa_K3799002) under IPTG inducible Ecoli promoter(BBa_R0010) aalong with RBS(BBa_B0034) and double terminator(BBa_B0015)

Usage and Biology

Bovine pancreatic DNase I is a double-strand specific endonuclease that degrades DNA. Bovine pancreatic deoxyribonuclease I (DNase I) is a DNA minor grove-interacting nuclease, which shows relatively low specificity.Bovine pancreatic deoxyribonuclease I (bpDNase) cleaves double-stranded DNA with no sequence specificity making it suitable for degradation of bacterial biofilm.Deoxyribonuclease I (DNase I) enzymes cleave single or double-stranded DNA and require divalent metal ions to hydrolyze DNA yielding 3΄-hydroxyl and 5΄-phosphorylated products

Sequence and Features



Assembly Compatibility:
  • 10
    INCOMPATIBLE WITH RFC[10]
    Unknown
  • 12
    INCOMPATIBLE WITH RFC[12]
    Unknown
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]



Cloning and expression

The coding sequence for DNaseI was initially found from NCBI and then procured synthetically adding biobrick prefix and suffix from TwistBioscience.Cloning was carried out following Normal biobrick assembly using combination of EcoRI and PstI.Linearized plasmid back bone of PSBIC3 obtained by PCR amplification using Plasmid specific primers and Gene fragment were digested with EcoRI and PstI and further ligated .The resultant plasmid was transformed into Ecoli DH5α.Transformed colonies were identified and further confirmed using colony PCR.

Colony PCR result of DnaseI composite part succesful.An estimated size of 1512 bp determined using Snapgene insilico PCR
Primers used

Biobrick Forward- gatggaattcgcggccgcttctag, Biobrick reverse- gatgctgcagcggccgctactagta

Plasmid backbone forward- gctgcagtccggcaaaaaa, Plasmid backbone reverse- gtgaattccagaaatcatccttagcg

Sequencing forward- tgccacctgacgtctaagaa, Sequencing reverse- attaccgcctttgagtgagc

Due to time and space constraints for purification of protein,characterization of DNaseI was carried out using industrially prepared DNaseI from Sigma aldrich(D2025)

Characterization

We determined the activity of DNaseI on biofilm of Pseudomonas aeruginosa using 96 well plate biofilm assay.We did the assay at two different stages to determine the optimum concentration and time required for maximum degradation rate of bacterial biofilm.


Pretreatment of bacterial biofilm with DNaseI

Pretreatment was done to determine the optimum concentration of DNaseI which gives maximum degradation of Pseudomonas biofilm.Bacterial biofilm was grown in 96 well plates in medium containing DNaseI supplemented at different concentration ranging from 0-25 µg/ml for 72 hours.Biofilm was quantified by checking absorbance at 595 nm after Crystal violet staining.Biofilm degradation rate was compared by calculating biofilm percentage reduction which is given by

BBa K3799002--equation.jpeg



Biofilm percentage reduction under varying concentration of DNaseI

It was observed that at a concentration of 10 µg/ml gave maximum BPR.BPR didnt further increase with higher concentrations.This concentration was taken as a standard for further experiments.

Posttreatment of bacterial biofilm with DNaseI

Posttreatment was done to determine the optimum incubation time of DNaseI to get maximum degradation.Bacterial biofilm was grown in 96 well plates for 72 hours to get maximum yield.Following this,bacterial colonies were washed off and the pure biofilm in wells were treated with DNaseI supplemented in media at a concentration of 10 µg/ml.Different wells were incubated for time points ranging from 0-50 min.Biofilm yield per condition was quantified by measuring absorbance at 595 nm after crystal violet treatment.Biofilm percentage reduction was further determined to compare degradation rate at different time point.

Biofilm percentage reduction by DNaseI for different incubation time

Wells incubated for 40 min showed maximum biofilm degradation.