Difference between revisions of "Collections/BIOFAB"

(How is the BIOFAB collection useful to you?)
(How does it work?)
Line 10: Line 10:
 
The BIOFAB collection contains constitutive promoters, transcription terminators, and 5' untranslated regions (5' UTRs). The promoters and terminators were added to the iGEM Parts Registry by the 2018 and 2020 FSU iGEM teams. The promoters have a range of strength that spans four orders of magnitude. Promoters of different strengths can be selected from the BIOFAB collection based on the desired levels of gene expression. The original BIOFAB promoters and terminators were tested using a specific transcription unit designed by the BIOFAB team. The FSU iGEM teams are measuring the strength of the promoters in a genetic context composed of iGEM parts. Specifically, using the pSB1C3 and pSB1K3 backbones. It is recommend that users of the BIOFAB Collection select several promoters with the desired strength when working on a new design to determine experimentally which promoter provides the desired level of gene expression.
 
The BIOFAB collection contains constitutive promoters, transcription terminators, and 5' untranslated regions (5' UTRs). The promoters and terminators were added to the iGEM Parts Registry by the 2018 and 2020 FSU iGEM teams. The promoters have a range of strength that spans four orders of magnitude. Promoters of different strengths can be selected from the BIOFAB collection based on the desired levels of gene expression. The original BIOFAB promoters and terminators were tested using a specific transcription unit designed by the BIOFAB team. The FSU iGEM teams are measuring the strength of the promoters in a genetic context composed of iGEM parts. Specifically, using the pSB1C3 and pSB1K3 backbones. It is recommend that users of the BIOFAB Collection select several promoters with the desired strength when working on a new design to determine experimentally which promoter provides the desired level of gene expression.
  
==How does it work?==
+
==How do the BIOFAB promoters work?==
  
The promoters on this page are listed in order of decreasing strength. The strongest promoters produce the most RNA transcripts of their downstream gene, while the weakest promoters produce the fewest RNA transcripts. The promoter strength is determined by how strongly the DNA sequence recruits RNA polymerase. Stronger promoters are better able to recruit RNA polymerase, so they cause transcription to occur more frequently. Weaker promoters cannot recruit RNA polymerase as effectively, so they cause transcription to occur less frequently.  
+
The promoters on this page are listed in order of decreasing strength based on the measurements reported by the BIOFAB team. The strongest promoters are expected to produce more messenger RNA (mRNA) than the weaker promoters. The promoter strength is determined by how frequently the DNA sequence recruits RNA polymerases and encourages transcription.
  
 
==How was it built?==
 
==How was it built?==

Revision as of 20:59, 21 October 2021

This collection is a user contributed collection, and is not under curation by iGEM HQ/Registry.

This collection is curated by the FSU iGEM teams

How is the BIOFAB collection useful to you?

The BIOFAB collection contains constitutive promoters, transcription terminators, and 5' untranslated regions (5' UTRs). The promoters and terminators were added to the iGEM Parts Registry by the 2018 and 2020 FSU iGEM teams. The promoters have a range of strength that spans four orders of magnitude. Promoters of different strengths can be selected from the BIOFAB collection based on the desired levels of gene expression. The original BIOFAB promoters and terminators were tested using a specific transcription unit designed by the BIOFAB team. The FSU iGEM teams are measuring the strength of the promoters in a genetic context composed of iGEM parts. Specifically, using the pSB1C3 and pSB1K3 backbones. It is recommend that users of the BIOFAB Collection select several promoters with the desired strength when working on a new design to determine experimentally which promoter provides the desired level of gene expression.

How do the BIOFAB promoters work?

The promoters on this page are listed in order of decreasing strength based on the measurements reported by the BIOFAB team. The strongest promoters are expected to produce more messenger RNA (mRNA) than the weaker promoters. The promoter strength is determined by how frequently the DNA sequence recruits RNA polymerases and encourages transcription.

How was it built?

The 2018 FSU iGEM team measured the expression levels of three BIOFAB promoters in iGEM plasmids. A test device was created, which contained a BIOFAB promoter, a ribosome binding site (part B0034), a red fluorescent protein (part mRFP1 E1010), and a double terminator(part B0015). (make the names of these parts hyperlinks to their webpages) The test device was incorporated into the plasmid pSB1C3, which gives transformed bacteria resistance to chloramphenicol.

[plasmid map]

The test device was created by combining the pSB1C3 backbone with two overlapping DNA inserts. The first insert contained the biobrick prefix, the BIOFAB promoter, and part of the mRFP1 gene. The second insert contained the full mRFP1 gene, the double terminator, and the biobrick suffix. The three DNA sequences were then combined into one plasmid using the NEB Hifi DNA Assembly Master Mix protocol. This procedure combines multiple pieces of DNA that share overlapping sequences into a single DNA molecule. The partial mRFP1 sequence on the first insert overlaps with the full mRFP1 gene on the second insert, so the Hifi Assembly method combines the two inserts into a single DNA oligo. The combined insert begins with a biobrick prefix and ends with a biobrick suffix, which overlap with the prefix and suffix that are found on the plasmid. Once the insert is assembled into the plasmid, the final plasmid is complete.

Libraries

Modular Promoter Library

iGEM: BBa_M36303
BIOFAB ID: apFAB46
Strength: 897
897
iGEM: BBa_K2832101
BIOFAB ID: apFAB70
Strength: 866.7
866.7
iGEM: BBa_K2832102
BIOFAB ID: apFAB71
Strength: 866
866
iGEM: BBa_K2832103
BIOFAB ID: apFAB61
Strength: 857
857

Randomized Promoter Library

Terminator Library

References

Mutalik, V., Guimaraes, J., Cambray, G. et al. Precise and reliable gene expression via standard transcription and translation initiation elements. Nat Methods 10, 354–360 (2013). https://doi.org/10.1038/nmeth.2404

The data visualization is provided by the Charts.css library. You can use the Charts.css 0.9.0 library in your wiki page by adding the {{FSU/ChartsCSS}} template to the page.

Tables Generated by the Parts Registry

Modular Promoters Table


More...
NameDescriptionTypeCreated bylengthusesseq
BBa_K2832100BIOFAB Modular Promoter apFAB46RegulatoryBIOFAB471 . . . cgcatctttttgtacctataatagattcat
BBa_K2832101BIOFAB Modular Promoter apFAB70RegulatoryBIOFAB37  . . . cgcatctttttgtacctataatgtgtggat
BBa_K2832102BIOFAB Modular Promoter apFAB71RegulatoryBIOFAB37  . . . cgcatctttttgtacctataatagattcat
BBa_K2832103BIOFAB Modular Promoter apFAB61RegulatoryBIOFAB37  . . . ttaatcatccggctcgtataatagattcat
BBa_K2832104BIOFAB Modular Promoter apFAB80RegulatoryBIOFAB49  . . . aagtctaacctataggtataatgtgtggat
BBa_K2832105BIOFAB Modular Promoter apFAB45RegulatoryBIOFAB47  . . . cgcatctttttgtacctataatgtgtggat
BBa_K2832106BIOFAB Modular Promoter apFAB47RegulatoryBIOFAB47  . . . cgcatctttttgtacccataattatttcat
BBa_K2832107BIOFAB modular Promoter apFAB31RegulatoryBIOFAB48  . . . aagtctaacctataggtataatagattcat
BBa_K2832108BIOFAB modular Promoter apFAB55RegulatoryBIOFAB38  . . . aagtctaacctataggtataatgtgtggat
BBa_K2832109BIOFAB modular Promoter apFAB68RegulatoryBIOFAB37  . . . caggaaaatttttctgtagatttaacgtat
BBa_K2832110BIOFAB modular Promoter apFAB101RegulatoryBIOFAB48  . . . ttatcccttgcggcgatataatagattcat
BBa_K2832111BIOFAB Modular Promoter apFAB96RegulatoryBIOFAB48  . . . cgcatctttttgtacctataatagattcat
BBa_K2832112BIOFAB Modular Promoter apFAB56RegulatoryBIOFAB38  . . . aagtctaacctataggtataatagattcat
BBa_K2832113BIOFAB Modular Promoter apFAB81RegulatoryBIOFAB49  . . . aagtctaacctataggtataatagattcat
BBa_K2832114BIOFAB Modular Promoter apFAB92RegulatoryBIOFAB48  . . . caggaaaatttttctgcataattatttcat
BBa_K2832115BIOFAB Modular Promoter apFAB72RegulatoryBIOFAB37  . . . cgcatctttttgtacccataattatttcat
BBa_K2832116BIOFAB Modular Promoter apFAB100RegulatoryBIOFAB48  . . . ttatcccttgcggcgatataatgtgtggat
BBa_K2832117BIOFAB Modular Promoter apFAB76RegulatoryBIOFAB37  . . . ttatcccttgcggcgatataatagattcat
BBa_K2832118BIOFAB Modular Promoter apFAB30RegulatoryBIOFAB48  . . . aagtctaacctataggtataatgtgtggat
BBa_K2832119BIOFAB Modular Promoter apFAB79RegulatoryBIOFAB49  . . . aagtctaacctataggatacttacagccat
BBa_K2832120BIOFAB Modular Promoter apFAB75RegulatoryBIOFAB37  . . . ttatcccttgcggcgatataatgtgtggat
BBa_K2832121BIOFAB Modular Promoter apFAB50RegulatoryBIOFAB47  . . . ttatcccttgcggcgatataatgtgtggat
BBa_K2832122BIOFAB Modular Promoter apFAB93RegulatoryBIOFAB48  . . . caggaaaatttttctgtagatttaacgtat
BBa_K2832123BIOFAB Modular Promoter apFAB60RegulatoryBIOFAB37  . . . ttaatcatccggctcgtataatgtgtggat
BBa_K2832124BIOFAB Modular Promoter apFAB54RegulatoryBIOFAB38  . . . aagtctaacctataggatacttacagccat
BBa_K2832125BIOFAB Modular Promoter apFAB62RegulatoryBIOFAB37  . . . ttaatcatccggctcgcataattatttcat
BBa_K2832126BIOFAB Modular Promoter apFAB42RegulatoryBIOFAB47  . . . caggaaaatttttctgcataattatttcat
BBa_K2832127BIOFAB Modular Promoter apFAB53RegulatoryBIOFAB47  . . . ttatcccttgcggcgatagatttaacgtat
BBa_K2832128BIOFAB Modular Promoter apFAB85RegulatoryBIOFAB48  . . . ttaatcatccggctcgtataatgtgtggat
BBa_K2832129BIOFAB Modular Promoter apFAB65RegulatoryBIOFAB37  . . . caggaaaatttttctgtataatgtgtggat
BBa_K2832130BIOFAB Modular Promoter apFAB52RegulatoryBIOFAB47  . . . ttatcccttgcggcgacataattatttcat
BBa_K2832131BIOFAB Modular Promoter apFAB67RegulatoryBIOFAB37  . . . caggaaaatttttctgcataattatttcat
BBa_K2832132BIOFAB Modular Promoter apFAB32RegulatoryBIOFAB48  . . . aagtctaacctataggcataattatttcat
BBa_K2832133BIOFAB Modular Promoter apFAB57RegulatoryBIOFAB38  . . . aagtctaacctataggcataattatttcat
BBa_K2832134BIOFAB Modular Promoter apFAB39RegulatoryBIOFAB47  . . . caggaaaatttttctgatacttacagccat
BBa_K2832135BIOFAB Modular Promoter apFAB115RegulatoryBIOFAB37  . . . caggaaaatttttctgtataatgtgtggat
BBa_K2832136BIOFAB Modular Promoter apFAB29RegulatoryBIOFAB48  . . . aagtctaacctataggatacttacagccat
BBa_K2832137BIOFAB Modular Promoter apFAB77RegulatoryBIOFAB37  . . . ttatcccttgcggcgacataattatttcat
BBa_K2832138BIOFAB Modular Promoter apFAB36RegulatoryBIOFAB47  . . . ttaatcatccggctcgtataatagattcat
BBa_K2832139BIOFAB Modular Promoter apFAB44RegulatoryBIOFAB47  . . . cgcatctttttgtaccatacttacagccat
BBa_K2832140BIOFAB Modular Promoter apFAB102RegulatoryBIOFAB48  . . . ttatcccttgcggcgacataattatttcat
BBa_K2832141BIOFAB Modular Promoter apFAB37RegulatoryBIOFAB47  . . . ttaatcatccggctcgcataattatttcat
BBa_K2832142BIOFAB Modular Promoter apFAB41RegulatoryBIOFAB47  . . . caggaaaatttttctgtataatagattcat
BBa_K2832143BIOFAB Modular Promoter apFAB63RegulatoryBIOFAB37  . . . ttaatcatccggctcgtagatttaacgtat
BBa_K2832144BIOFAB Modular Promoter apFAB140RegulatoryBIOFAB45  . . . caggaaaatttttctgtataatgtgtggat
BBa_K2832145bIOFAB Modular Promoter apFAB64RegulatoryBIOFAB37  . . . caggaaaatttttctgatacttacagccat
BBa_K2832146BIOFAB Modular Promoter apFAB40RegulatoryBIOFAB47  . . . caggaaaatttttctgtataatgtgtggat
BBa_K2832147BIOFAB Modular Promoter apFAB97RegulatoryBIOFAB48  . . . cgcatctttttgtacccataattatttcat
BBa_K2832148BIOFAB modular Promoter apFAB78RegulatoryBIOFAB37  . . . ttatcccttgcggcgatagatttaacgtat
BBa_K2832149BIOFAB Modular Promoter apFAB69RegulatoryBIOFAB37  . . . cgcatctttttgtaccatacttacagccat
BBa_K2832150BIOFAB Modular Promoter apFAB103RegulatoryBIOFAB48  . . . ttatcccttgcggcgatagatttaacgtat
BBa_K2832151BIOFAB Modular Promoter apFAB73RegulatoryBIOFAB37  . . . cgcatctttttgtacctagatttaacgtat
BBa_K2832152BIOFAB Modular Promoter apFAB66RegulatoryBIOFAB37  . . . caggaaaatttttctgtataatagattcat
BBa_K2832153BIOFAB Modular Promoter apFAB126RegulatoryBIOFAB37  . . . ttatcccttgcggcgatataatagattcat
BBa_K2832154BIOFAB Modular Promoter apFAB95RegulatoryBIOFAB48  . . . cgcatctttttgtacctataatgtgtggat
BBa_K2832155BIOFAB Modular Promoter apFAB151RegulatoryBIOFAB45  . . . ttatcccttgcggcgatataatagattcat
BBa_K2832156BIOFAB Modular Promoter apFAB48RegulatoryBIOFAB47  . . . cgcatctttttgtacctagatttaacgtat
BBa_K2832157BIOFAB Modular Promoter apFAB82RegulatoryBIOFAB491 . . . aagtctaacctataggcataattatttcat
BBa_K2832158BIOFAB Modular Promoter apFAB141RegulatoryBIOFAB45  . . . caggaaaatttttctgtataatagattcat
BBa_K2832159BIOFAB Modular Promoter apFAB150RegulatoryBIOFAB45  . . . ttatcccttgcggcgatataatgtgtggat
BBa_K2832160BIOFAB Modular Promoter apFAB125RegulatoryBIOFAB37  . . . ttatcccttgcggcgatataatgtgtggat
BBa_K2832161BIOFAB Modular Promoter apFAB33RegulatoryBIOFAB48  . . . aagtctaacctataggtagatttaacgtat
BBa_K2832162BIOFAB Modular Promoter apFAB121RegulatoryBIOFAB37  . . . cgcatctttttgtacctataatagattcat
BBa_K2832163BIOFAB modular Promoter apFAB111RegulatoryBIOFAB37  . . . ttaatcatccggctcgtataatagattcat
BBa_K2832164BIOFAB modular Promoter apFAB58RegulatoryBIOFAB38  . . . aagtctaacctataggtagatttaacgtat
BBa_K2832165BIOFAB modular Promoter apFAB94RegulatoryBIOFAB48  . . . cgcatctttttgtaccatacttacagccat
BBa_K2832166BIOFAB modular Promoter apFAB145RegulatoryBIOFAB45  . . . cgcatctttttgtacctataatgtgtggat
BBa_K2832167BIOFAB Modular Promoter apFAB118RegulatoryBIOFAB37  . . . caggaaaatttttctgtagatttaacgtat
BBa_K2832168BIOFAB Modular Promoter apFAB106RegulatoryBIOFAB38  . . . aagtctaacctataggtataatagattcat
BBa_K2832169BIOFAB Modular Promoter apFAB110RegulatoryBIOFAB37  . . . ttaatcatccggctcgtataatgtgtggat
BBa_K2832170BIOFAB Modular Promoter apFAB105RegulatoryBIOFAB38  . . . aagtctaacctataggtataatgtgtggat
BBa_K2832171BIOFAB Modular Promoter apFAB38RegulatoryBIOFAB47  . . . ttaatcatccggctcgtagatttaacgtat
BBa_K2832172BIOFAB Modular Promoter apFAB89RegulatoryBIOFAB48  . . . caggaaaatttttctgatacttacagccat
BBa_K2832173BIOFAB Modular Promoter apFAB142RegulatoryBIOFAB45  . . . caggaaaatttttctgcataattatttcat
BBa_K2832174BIOFAB Modular Promoter apFAB130RegulatoryBIOFAB46  . . . aagtctaacctataggtataatgtgtggat
BBa_K2832175BIOFAB Modular Promoter apFAB131RegulatoryBIOFAB46  . . . aagtctaacctataggtataatagattcat
BBa_K2832176BIOFAB Modular Promoter apFAB143RegulatoryBIOFAB45  . . . caggaaaatttttctgtagatttaacgtat
BBa_K2832177BIOFAB Modular Promoter apFAB87RegulatoryBIOFAB48  . . . ttaatcatccggctcgcataattatttcat
BBa_K2832178BIOFAB Modular Promoter apFAB104RegulatoryBIOFAB38  . . . aagtctaacctataggatacttacagccat
BBa_K2832179BIOFAB Modular Promoter apFAB98RegulatoryBIOFAB48  . . . cgcatctttttgtacctagatttaacgtat
BBa_K2832180BIOFAB Modular Promoter apFAB51RegulatoryBIOFAB47  . . . ttatcccttgcggcgatataatagattcat
BBa_K2832181BIOFAB Modular Promoter apFAB49RegulatoryBIOFAB47  . . . ttatcccttgcggcgaatacttacagccat
BBa_K2832182BIOFAB Modular Promoter apFAB120RegulatoryBIOFAB37  . . . cgcatctttttgtacctataatgtgtggat
BBa_K2832183BIOFAB Modular Promoter apFAB83RegulatoryBIOFAB49  . . . aagtctaacctataggtagatttaacgtat
BBa_K2832184BIOFAB Modular Promoter apFAB117RegulatoryBIOFAB37  . . . caggaaaatttttctgcataattatttcat
BBa_K2832185BIOFAB Modular Promoter apFAB129RegulatoryBIOFAB46  . . . aagtctaacctataggatacttacagccat
BBa_K2832186BIOFAB Modular Promoter apFAB146RegulatoryBIOFAB45  . . . cgcatctttttgtacctataatagattcat
BBa_K2832187BIOFAB Modular Promoter apFAB59RegulatoryBIOFAB37  . . . ttaatcatccggctcgatacttacagccat
BBa_K2832188BIOFAB Modular Promoter apFAB127RegulatoryBIOFAB37  . . . ttatcccttgcggcgacataattatttcat
BBa_K2832189BIOFAB Modular Promoter apFAB88RegulatoryBIOFAB48  . . . ttaatcatccggctcgtagatttaacgtat
BBa_K2832190BIOFAB Modular Promoter apFAB86RegulatoryBIOFAB48  . . . ttaatcatccggctcgtataatagattcat
BBa_K2832191BIOFAB Modular Promoter apFAB74RegulatoryBIOFAB37  . . . ttatcccttgcggcgaatacttacagccat
BBa_K2832192BIOFAB Modular Promoter apFAB152RegulatoryBIOFAB45  . . . ttatcccttgcggcgacataattatttcat
BBa_K2832193BIOFAB Modular Promoter apFAB122RegulatoryBIOFAB37  . . . cgcatctttttgtacccataattatttcat
BBa_K2832194BIOFAB Modular Promoter apFAB128RegulatoryBIOFAB37  . . . ttatcccttgcggcgatagatttaacgtat
BBa_K2832195BIOFAB Modular Promoter apFAB99RegulatoryBIOFAB48  . . . ttatcccttgcggcgaatacttacagccat
BBa_K2832196BIOFAB Modular Promoter apFAB119RegulatoryBIOFAB37  . . . cgcatctttttgtaccatacttacagccat
BBa_K2832197BIOFAB Modular Promoter apFAB112RegulatoryBIOFAB37  . . . ttaatcatccggctcgcataattatttcat
BBa_K2832198BIOFAB Modular Promoter apFAB34RegulatoryBIOFAB47  . . . ttaatcatccggctcgatacttacagccat
BBa_K2832199BIOFAB Modular Promoter apFAB147RegulatoryBIOFAB45  . . . cgcatctttttgtacccataattatttcat
BBa_K2832200BIOFAB Modular Promoter apFAB144RegulatoryBIOFAB45  . . . cgcatctttttgtaccatacttacagccat
BBa_K2832201BIOFAB Modular Promoter apFAB35RegulatoryBIOFAB47  . . . ttaatcatccggctcgtataatgtgtggat
BBa_K2832202BIOFAB modular Promoter apFAB107RegulatoryBIOFAB38  . . . aagtctaacctataggcataattatttcat
BBa_K2832203BIOFAB modular Promoter apFAB123RegulatoryBIOFAB37  . . . cgcatctttttgtacctagatttaacgtat
BBa_K2832204BIOFAB Modular Promoter apFAB137RegulatoryBIOFAB45  . . . ttaatcatccggctcgcataattatttcat
BBa_K2832205BIOFAB Modular Promoter apFAB113RegulatoryBIOFAB37  . . . ttaatcatccggctcgtagatttaacgtat
BBa_K2832206BIOFAB Modular Promoter apFAB84RegulatoryBIOFAB48  . . . ttaatcatccggctcgatacttacagccat
BBa_K2832207BIOFAB Modular Promoter apFAB148RegulatoryBIOFAB45  . . . cgcatctttttgtacctagatttaacgtat
BBa_K2832208BIOFAB Modular Promoter apFAB108RegulatoryBIOFAB38  . . . aagtctaacctataggtagatttaacgtat
BBa_K2832209BIOFAB Modular Promoter apFAB114RegulatoryBIOFAB37  . . . caggaaaatttttctgatacttacagccat
BBa_K2832210BIOFAB Modular Promoter apFAB136RegulatoryBIOFAB45  . . . ttaatcatccggctcgtataatagattcat
BBa_K2832211BIOFAB Modular Promoter apFAB124RegulatoryBIOFAB37  . . . ttatcccttgcggcgaatacttacagccat
BBa_K2832212BIOFAB Modular Promoter apFAB149RegulatoryBIOFAB45  . . . ttatcccttgcggcgaatacttacagccat
BBa_K2832213BIOFAB Modular Promoter apFAB134RegulatoryBIOFAB45  . . . ttaatcatccggctcgatacttacagccat
BBa_K2832214BIOFAB Modular Promoter apFAB138RegulatoryBIOFAB45  . . . ttaatcatccggctcgtagatttaacgtat
BBa_K2832215BIOFAB Modular Promoter apFAB43RegulatoryBIOFAB47  . . . caggaaaatttttctgtagatttaacgtat
BBa_K2832216BIOFAB Modular Promoter apFAB133RegulatoryBIOFAB46  . . . aagtctaacctataggtagatttaacgtat
BBa_K2832217BIOFAB Modular Promoter apFAB139RegulatoryBIOFAB45  . . . caggaaaatttttctgatacttacagccat
BBa_K2832218BIOFAB Modular Promoter apFAB91RegulatoryBIOFAB48  . . . caggaaaatttttctgtataatagattcat
BBa_K2832219BIOFAB Modular Promoter apFAB90RegulatoryBIOFAB481 . . . caggaaaatttttctgtataatgtgtggat

Randomized Promoters Table


More...
NameDescriptionTypeCreated bylengthusesseq
BBa_J97008BIOFAB Random Promoter apFAB342RegulatoryBIOFAB36-1 . . . attaatcatccggctcataaaatttgtgga
BBa_K3702000BIOFAB Random Promoter apFAB347RegulatoryBIOFAB36-1 . . . attaatcatccggctcttaatatgtgtgga
BBa_K3702001BIOFAB Random Promoter apFAB345RegulatoryBIOFAB36-1 . . . attaatcatccggctcgtagagtatgtgga
BBa_K3702002BIOFAB Random Promoter apFAB341RegulatoryBIOFAB36-1 . . . attaatcatccggctcgtaatatgtgtgga
BBa_K3702003BIOFAB Random Promoter apFAB317RegulatoryBIOFAB36-1 . . . tttaatcatccggctcgtataatgtgtgga
BBa_K3702004BIOFAB Random Promoter apFAB338RegulatoryBIOFAB36-1 . . . attaatcatccggctcctaggatgtgtgga
BBa_K3702005BIOFAB Random Promoter apFAB323RegulatoryBIOFAB36-1 . . . tttaatcatccggctcgtataatgtgtgga
BBa_K3702006BIOFAB Random Promoter apFAB339RegulatoryBIOFAB36-1 . . . attaatcatccggctcgtaatttatgtgga
BBa_K3702007BIOFAB Random Promoter apFAB321RegulatoryBIOFAB36-1 . . . attaatcatccggctcgtaacttatgtgga
BBa_K3702008BIOFAB Random Promoter apFAB340RegulatoryBIOFAB36-1 . . . attaatcatccggctcgtagtatgtgtgga
BBa_K3702009BIOFAB Random Promoter apFAB322RegulatoryBIOFAB36-1 . . . attaatcatccggctcgtataatgtgtgga
BBa_K3702010BIOFAB Random Promoter apFAB346RegulatoryBIOFAB36-1 . . . attaatcatccggctcgtaatgtttgtgga
BBa_K3702011BIOFAB Random Promoter apFAB303RegulatoryBIOFAB35-1 . . . tcttaatcatcggctcgtataatgtgtgga
BBa_K3702012BIOFAB Random Promoter apFAB302RegulatoryBIOFAB36-1 . . . tttaatcatccggctcgtataatgtgtgga
BBa_K3702013BIOFAB Random Promoter apFAB297RegulatoryBIOFAB36-1 . . . tttaatcatccggctcgtataatgtgtgga
BBa_K3702014BIOFAB Random Promoter apFAB301RegulatoryBIOFAB36-1 . . . tttaatcatccggctcgtataatgtgtgga
BBa_K3702015BIOFAB Random Promoter apFAB298RegulatoryBIOFAB36-1 . . . cttaatcatccggctcgtataatgtgtgga
BBa_K3702016BIOFAB Random Promoter apFAB306RegulatoryBIOFAB36-1 . . . attaatcatccggctcgtagtgtttgtgga
BBa_K3702017BIOFAB Random Promoter apFAB307RegulatoryBIOFAB36-1 . . . attaatcatccggctcatatcgtttgtgga
BBa_K3702018BIOFAB Random Promoter apFAB296RegulatoryBIOFAB36-1 . . . tttaatcatccggctcgtataatgtgtgga
BBa_K3702019BIOFAB Random Promoter apFAB308RegulatoryBIOFAB36-1 . . . attaatcatccggctcgtaggttatgtgga
BBa_K3702020BIOFAB Random Promoter apFAB295RegulatoryBIOFAB35-1 . . . tcttaatcatcggctcgtataatgtgtgga
BBa_K3702021BIOFAB Random Promoter apFAB300RegulatoryBIOFAB36-1 . . . cttaatcatccggctcgtataatgtgtgga
BBa_K3702022BIOFAB Random Promoter apFAB299RegulatoryBIOFAB36-1 . . . tttaatcatccggctcgtataatgtgtgga
BBa_K3702023BIOFAB Random Promoter apFAB309RegulatoryBIOFAB36-1 . . . attaatcatccggctcgtagtgtctgtgga
BBa_K3702024BIOFAB Random Promoter apFAB305RegulatoryBIOFAB36-1 . . . attaatcatccggctcgtagggtttgtgga
BBa_K3702025BIOFAB Random Promoter apFAB313RegulatoryBIOFAB36-1 . . . attaatcatccggctcttagggtgtgtgga
BBa_K3702026BIOFAB Random Promoter apFAB310RegulatoryBIOFAB36-1 . . . attaatcatccggctcctatcttctgtgga
BBa_K3702027BIOFAB Random Promoter apFAB311RegulatoryBIOFAB36-1 . . . attaatcatccggctcgtaggttgtgtgga
BBa_K3702028BIOFAB Random Promoter apFAB279RegulatoryBIOFAB35-1 . . . ctttaatcatcggctcgtataatgtgtgga
BBa_K3702029BIOFAB Random Promoter apFAB314RegulatoryBIOFAB36-1 . . . attaatcatccggctcctaagttgtgtgga
BBa_K3702030BIOFAB Random Promoter apFAB281RegulatoryBIOFAB36-1 . . . tttaatcatccggctcgtataatgtgtgga
BBa_K3702031BIOFAB Random Promoter apFAB276RegulatoryBIOFAB35-1 . . . tattaatcatcggctcgtataatgtgtgga
BBa_K3702032BIOFAB Random Promoter apFAB312RegulatoryBIOFAB36-1 . . . attaatcatccggctcttagtgtttgtgga
BBa_K3702033BIOFAB Random Promoter apFAB273RegulatoryBIOFAB36-1 . . . tttaatcatccggctcgtataatgtgtgga
BBa_K3702034BIOFAB Random Promoter apFAB316RegulatoryBIOFAB36-1 . . . attaatcatccggctcatatagtatgtgga
BBa_K3702035BIOFAB Random Promoter apFAB282RegulatoryBIOFAB36-1 . . . cttaatcatccggctcgtataatgtgtgga
BBa_K3702036BIOFAB Random Promoter apFAB260RegulatoryBIOFAB35-1 . . . tgttaatcatcggctcgtataatgtgtgga
BBa_K3702037BIOFAB Random Promoter apFAB293RegulatoryBIOFAB36-1 . . . attaatcatccggctcttaggttgtgtgga
BBa_K3702038BIOFAB Random Promoter apFAB259RegulatoryBIOFAB36-1 . . . cttaatcatccggctcgtataatgtgtgga
BBa_K3702039BIOFAB Random Promoter apFAB284RegulatoryBIOFAB36-1 . . . attaatcatccggctcataagttttgtgga
BBa_K3702040BIOFAB Random Promoter apFAB285RegulatoryBIOFAB36-1 . . . attaatcatccggctcctagcctctgtgga
BBa_K3702041BIOFAB Random Promoter apFAB286RegulatoryBIOFAB36-1 . . . attaatcatccggctcttagtttttgtgga
BBa_K3702042BIOFAB Random Promoter apFAB257RegulatoryBIOFAB36-1 . . . gttaatcatccggctcgtataatgtgtgga
BBa_K3702043BIOFAB Random Promoter apFAB267RegulatoryBIOFAB36-1 . . . attaatcatccggctcgtagggtctgtgga
BBa_K3702044BIOFAB Random Promoter apFAB263RegulatoryBIOFAB36-1 . . . gttaatcatccggctcgtataatgtgtgga
BBa_K3702045BIOFAB Random Promoter apFAB262RegulatoryBIOFAB36-1 . . . attaatcatccggctcgtataatgtgtgga
BBa_K3702046BIOFAB Random Promoter apFAB265RegulatoryBIOFAB35-1 . . . tattaatcatcggctcatccattatgtgga
BBa_K3702047BIOFAB Random Promoter apFAB271RegulatoryBIOFAB36-1 . . . attaatcatccggctcttagcgtgtgtgga
BBa_K3702048BIOFAB Random Promoter apFAB278RegulatoryBIOFAB36-1 . . . gttaatcatccggctcgtataatgtgtgga
BBa_K3702049BIOFAB Random Promoter apFAB241RegulatoryBIOFAB35-1 . . . attaatcatccggctcgtataatgtgtgga
BBa_K3702050BIOFAB Random Promoter apFAB280RegulatoryBIOFAB36-1 . . . attaatcatccggctcgtataatgtgtgga
BBa_K3702051BIOFAB Random Promoter apFAB254RegulatoryBIOFAB36-1 . . . attaatcatccggctcgtataatgtgtgga
BBa_K3702052BIOFAB Random Promoter apFAB266RegulatoryBIOFAB35-1 . . . aattaatcatcggctcttaggctatgtgga
BBa_K3702053BIOFAB Random Promoter apFAB270RegulatoryBIOFAB35-1 . . . aattaatcatcggctcataaagtgtgtgga
BBa_K3702054BIOFAB Random Promoter apFAB287RegulatoryBIOFAB36-1 . . . attaatcatccggctcctagggtttgtgga
BBa_K3702055BIOFAB Random Promoter apFAB256RegulatoryBIOFAB36-1 . . . attaatcatccggctcgtataatgtgtgga
BBa_K3702056BIOFAB Random Promoter apFAB253RegulatoryBIOFAB36-1 . . . gttaatcatccggctcgtataatgtgtgga
BBa_K3702057BIOFAB Random Promoter apFAB264RegulatoryBIOFAB35-1 . . . ctttaatcatcggctcgtataatgtgtgga
BBa_K3702058BIOFAB Random Promoter apFAB337RegulatoryBIOFAB36-1 . . . cttaatcatccggctcgtataatgtgtgga
BBa_K3702059BIOFAB Random Promoter apFAB261RegulatoryBIOFAB36-1 . . . cttaatcatccggctcgtataatgtgtgga
BBa_K3702060BIOFAB Random Promoter apFAB272RegulatoryBIOFAB35-1 . . . aattaatcatcggctcgtagagtttgtgga
BBa_K3702061BIOFAB Random Promoter apFAB274RegulatoryBIOFAB36-1 . . . tttaatcatccggctcgtataatgtgtgga
BBa_K3702062BIOFAB Random Promoter apFAB258RegulatoryBIOFAB36-1 . . . attaatcatccggctcctagtttctgtgga
BBa_K3702063BIOFAB Random Promoter apFAB255RegulatoryBIOFAB35-1 . . . aattaatcatcggctcgtataatgtgtgga
BBa_K3702064BIOFAB Random Promoter apFAB268RegulatoryBIOFAB36-1 . . . attaatcatccggctcatagcgtgtgtgga
BBa_K3702065BIOFAB Random Promoter apFAB333RegulatoryBIOFAB36-1 . . . cttaatcatccggctcgtataatgtgtgga
BBa_K3702066BIOFAB Random Promoter apFAB326RegulatoryBIOFAB36-1 . . . cttaatcatccggctcgtataatgtgtgga
BBa_K3702067BIOFAB Random Promoter apFAB343RegulatoryBIOFAB36-1 . . . attaatcatccggctcatagcgtctgtgga
BBa_K3702068BIOFAB Random Promoter apFAB329RegulatoryBIOFAB36-1 . . . cttaatcatccggctcgtatcatatgtgga
BBa_K3702069BIOFAB Random Promoter apFAB332RegulatoryBIOFAB36-1 . . . attaatcatccggctcgtataatgtgtgga
BBa_K3702070BIOFAB Random Promoter apFAB252RegulatoryBIOFAB36-1 . . . attaatcatccggctcatatgctttgtgga
BBa_K3702071BIOFAB Random Promoter apFAB251RegulatoryBIOFAB36-1 . . . attaatcatccggctcttaggttctgtgga
BBa_K3702072BIOFAB Random Promoter apFAB226RegulatoryBIOFAB36-1 . . . attaatcatccggctcgtataatctgtgga
BBa_K3702073BIOFAB Random Promoter apFAB315RegulatoryBIOFAB36-1 . . . cttaatcatccggctcgtataatgtgtgga
BBa_K3702074BIOFAB Random Promoter apFAB335RegulatoryBIOFAB36-1 . . . cttaatcatccggctcgtataatgtgtgga
BBa_K3702075BIOFAB Random Promoter apFAB334RegulatoryBIOFAB36-1 . . . gttaatcatccggctcgtataatgtgtgga
BBa_K3702076BIOFAB Random Promoter apFAB319RegulatoryBIOFAB36-1 . . . cttaatcatccggctcgtataatgtgtgga
BBa_K3702077BIOFAB Random Promoter apFAB229RegulatoryBIOFAB36-1 . . . tttaatcatccggctcgtataatgtgtgga
BBa_K3702078BIOFAB Random Promoter apFAB228RegulatoryBIOFAB36-1 . . . tttaatcatccggctcgtataatgtgtgga
BBa_K3702079BIOFAB Random Promoter apFAB225RegulatoryBIOFAB36-1 . . . gttaatcatccggctcctataatttgtgga
BBa_K3702080BIOFAB Random Promoter apFAB224RegulatoryBIOFAB36-1 . . . tttaatcatccggctcgtagagtgtgtgga
BBa_K3702081BIOFAB Random Promoter apFAB324RegulatoryBIOFAB35-1 . . . aattaatcatcggctcttaggctttgtgga
BBa_K3702082BIOFAB Random Promoter apFAB230RegulatoryBIOFAB36-1 . . . cttaatcatccggctcgtataatgtgtgga
BBa_K3702083BIOFAB Random Promoter apFAB318RegulatoryBIOFAB36-1 . . . attaatcatccggctcgtataatgtgtgga
BBa_K3702084BIOFAB Random Promoter apFAB331RegulatoryBIOFAB36-1 . . . cttaatcatccggctcggagactttgtgga
BBa_K3702085BIOFAB Random Promoter apFAB304RegulatoryBIOFAB36-1 . . . gttaatcatccggctcgtataatgtgtgga
BBa_K3702086BIOFAB Random Promoter apFAB231RegulatoryBIOFAB36-1 . . . tttaatcatccggctcgtataatgtgtgga
BBa_K3702087BIOFAB Random Promoter apFAB227RegulatoryBIOFAB36-1 . . . cttaatcatccggctcgtataatgtgtgga
BBa_K3702088BIOFAB Random Promoter apFAB209RegulatoryBIOFAB36-1 . . . gttaatcatccggctcgtataatgtgtgga
BBa_K3702089BIOFAB Random Promoter apFAB202RegulatoryBIOFAB36-1 . . . gttaatcatccggctcgtataatctgtgga
BBa_K3702090BIOFAB Random Promoter apFAB212RegulatoryBIOFAB35-1 . . . ttttaatcatcggctcgtataatgtgtgga
BBa_K3702091BIOFAB Random Promoter apFAB211RegulatoryBIOFAB36-1 . . . gttaatcatccggctcgtataatgtgtgga
BBa_K3702092BIOFAB Random Promoter apFAB221RegulatoryBIOFAB36-1 . . . attaatcatccggctcatagactgtgtgga
BBa_K3702093BIOFAB Random Promoter apFAB205RegulatoryBIOFAB36-1 . . . cttaatcatccggctcgtattatatgtgga
BBa_K3702094BIOFAB Random Promoter apFAB201RegulatoryBIOFAB36-1 . . . cttaatcatccggctcctatagtgtgtgga
BBa_K3702095BIOFAB Random Promoter apFAB193RegulatoryBIOFAB36-1 . . . cttaatcatccggctcgtataatgtgtgga
BBa_K3702096BIOFAB Random Promoter apFAB203RegulatoryBIOFAB36-1 . . . gttaatcatccggctcgtagtctgtgtgga
BBa_K3702097BIOFAB Random Promoter apFAB200RegulatoryBIOFAB35-1 . . . aattaatcatcggctcttagggtttgtgga
BBa_K3702098BIOFAB Random Promoter apFAB207RegulatoryBIOFAB36-1 . . . tttaatcatccggctcatatactttgtgga
BBa_K3702099BIOFAB Random Promoter apFAB206RegulatoryBIOFAB36-1 . . . tttaatcatccggctcgtaccctttgtgga
BBa_K3702101BIOFAB Random Promoter apFAB208RegulatoryBIOFAB36-1 . . . gttaatcatccggctcgtataatgtgtgga
BBa_K3702102BIOFAB Random Promoter apFAB181RegulatoryBIOFAB36-1 . . . gttaatcatccggctcgtaaactgtgtgga
BBa_K3702103BIOFAB Random Promoter apFAB204RegulatoryBIOFAB36-1 . . . attaatcatccggctcctagtgtatgtgga
BBa_K3702104BIOFAB Random Promoter apFAB190RegulatoryBIOFAB35-1 . . . cgttaatcatcggctcgtataatgtgtgga
BBa_K3702105BIOFAB Random Promoter apFAB189RegulatoryBIOFAB35-1 . . . ccttaatcatcggctcgtataatgtgtgga
BBa_K3702106BIOFAB Random Promoter apFAB184RegulatoryBIOFAB36-1 . . . attaatcatccggctcgtacgatgtgtgga
BBa_K3702107BIOFAB Random Promoter apFAB215RegulatoryBIOFAB35-1 . . . ggttaatcatcggctcgtataatgtgtgga
BBa_K3702108BIOFAB Random Promoter apFAB168RegulatoryBIOFAB35-1 . . . cctaatcatccggctcgtataatgtgtgga
BBa_K3702109BIOFAB Random Promoter apFAB197RegulatoryBIOFAB35-1 . . . aattaatcatcggctcttaggttttgtgga
BBa_K3702110BIOFAB Random Promoter apFAB199RegulatoryBIOFAB35-1 . . . attaatcatccggctcgtagtgtgtgtgga
BBa_K3702111BIOFAB Random Promoter apFAB216RegulatoryBIOFAB36-1 . . . gttaatcatccggctcgtataatgtgtgga
BBa_K3702112BIOFAB Random Promoter apFAB180RegulatoryBIOFAB36-1 . . . attaatcatccggctcgtattgtatgtgga
BBa_K3702113BIOFAB Random Promoter apFAB187RegulatoryBIOFAB36-1 . . . gttaatcatccggctcgtatagtctgtgga
BBa_K3702114BIOFAB Random Promoter apFAB182RegulatoryBIOFAB36-1 . . . tttaatcatccggctcttaacttgtgtgga
BBa_K3702115BIOFAB Random Promoter apFAB186RegulatoryBIOFAB36-1 . . . gttaatcatccggctcgtatgttctgtgga
BBa_K3702116BIOFAB Random Promoter apFAB183RegulatoryBIOFAB36-1 . . . attaatcatccggctcctaggttatgtgga
BBa_K3702117BIOFAB Random Promoter apFAB195RegulatoryBIOFAB36-1 . . . attaatcatccggctcggaaagaatgtgga
BBa_K3702118BIOFAB Random Promoter apFAB167RegulatoryBIOFAB36-1 . . . attaatcatccggctcataaaatttgtgga
BBa_K3702119BIOFAB Random Promoter apFAB177RegulatoryBIOFAB36-1 . . . cttaatcatccggctcaggtgtaatgtgga
BBa_K3702120BIOFAB Random Promoter apFAB192RegulatoryBIOFAB36-1 . . . cttaatcatccggctcgtataatgtgtgga
BBa_K3702121BIOFAB Random Promoter apFAB220RegulatoryBIOFAB35-1 . . . aattaatcatcggctcatatggtctgtgga
BBa_K3702122BIOFAB Random Promoter apFAB161RegulatoryBIOFAB36-1 . . . cttaatcatccggctcttagagtatgtgga
BBa_K3702123BIOFAB Random Promoter apFAB160RegulatoryBIOFAB36-1 . . . cttaatcatccggctcttatagtttgtgga
BBa_K3702124BIOFAB Random Promoter apFAB162RegulatoryBIOFAB36-1 . . . attaatcatccggctcgtagtctgtgtgga
BBa_K3702125BIOFAB Random Promoter apFAB159RegulatoryBIOFAB36-1 . . . gttaatcatccggctcctagcatgtgtgga
BBa_K3702126BIOFAB Random Promoter apFAB164RegulatoryBIOFAB36-1 . . . attaatcatccggctcttaccgtttgtgga
BBa_K3702127BIOFAB Random Promoter apFAB166RegulatoryBIOFAB36-1 . . . cttaatcatctggctcatagtttatgtgga
BBa_K3702128BIOFAB Random Promoter apFAB157RegulatoryBIOFAB36-1 . . . attaatcatccggctcatattttttgtgga
BBa_K3702129BIOFAB Random Promoter apFAB217RegulatoryBIOFAB35-1 . . . aattaatcatcggctcctagggtttgtgga
BBa_K3702130BIOFAB Random Promoter apFAB156RegulatoryBIOFAB36-1 . . . gttaatcatccggctcctagtttgtgtgga
BBa_K3702131BIOFAB Random Promoter apFAB213RegulatoryBIOFAB36-1 . . . gttaatcatccggctcgtataatgtgtgga
BBa_K3702132BIOFAB Random Promoter apFAB325RegulatoryBIOFAB35-1 . . . aattaatatccggctcgtagcgtctgtgga
BBa_K3702133BIOFAB Random Promoter apFAB188RegulatoryBIOFAB35-1 . . . ccttaatcatcggctcgtataatgtgtgga
BBa_K3702134BIOFAB Random Promoter apFAB210RegulatoryBIOFAB35-1 . . . cgttaatcatcggctcgtataatgtgtgga
BBa_K3702135BIOFAB Random Promoter apFAB327RegulatoryBIOFAB36-1 . . . tttaatcatccggctcctactctgtgtgga
BBa_K3702136BIOFAB Random Promoter apFAB294RegulatoryBIOFAB36-1 . . . gttaatcatccggctcataaaatttgtgga

Terminators Table


More...
NameDescriptionTypeCreated bylengthusesseq
BBa_K3702161BIOFAB Terminator apFAB376TerminatorBIOFAB34-1 . . . aaaaaccccgcttcggcggggttttttcgc
BBa_K3702173BIOFAB Terminator apFAB388TerminatorBIOFAB39-1 . . . ccccgcccctgacagggcggggtttttttt
BBa_K3702137BIOFAB Terminator apFAB352TerminatorBIOFAB86-1 . . . gggggagagggaagtcatgaaaaaactaac
BBa_K3702138BIOFAB Terminator apFAB353TerminatorBIOFAB50-1 . . . atatttcgattgcatgtgcaattttttgca
BBa_K3702139BIOFAB Terminator apFAB354TerminatorBIOFAB33-1 . . . tcgcaaaaaaccccgctggggttttttcgc
BBa_K3702140BIOFAB Terminator apFAB355TerminatorBIOFAB80-1 . . . tgtctattatccctaagcccattttttgca
BBa_K3702141BIOFAB Terminator apFAB356TerminatorBIOFAB121-1 . . . tgcactaagcacataattgctcacagccaa
BBa_K3702142BIOFAB Terminator apFAB357TerminatorBIOFAB52-1 . . . gatacccagcccgcctaatcaatgcaaaca
BBa_K3702143BIOFAB Terminator apFAB358TerminatorBIOFAB31-1 . . . gcaaaaaaccccgctgcggggttttttcgc
BBa_K3702144BIOFAB Terminator apFAB359TerminatorBIOFAB83-1 . . . gggggagagggaagtcatgaaaaaactaac
BBa_K3702145BIOFAB Terminator apFAB360TerminatorBIOFAB40-1 . . . tgtctattatccctaagcccattttttgca
BBa_K3702146BIOFAB Terminator apFAB361TerminatorBIOFAB105-1 . . . cagccgtatgacaaggtcggcatcaggtgt
BBa_K3702147BIOFAB Terminator apFAB362TerminatorBIOFAB80-1 . . . cagccgcctgtcgcccgaaggccggtcggc
BBa_K3702148BIOFAB Terminator apFAB363TerminatorBIOFAB91-1 . . . gcgcggttgataacggttcagacaggttta
BBa_K3702149BIOFAB Terminator apFAB364TerminatorBIOFAB102-1 . . . cgataaagaagatttagcttcaaataaaac
BBa_K3702150BIOFAB Terminator apFAB365TerminatorBIOFAB108-1 . . . cagccgtatgacaaggtcggcatcaggtgt
BBa_K3702151BIOFAB Terminator apFAB366TerminatorBIOFAB109-1 . . . cagccgtatgacaaggtcggcatcaggtgt
BBa_K3702152BIOFAB Terminator apFAB367TerminatorBIOFAB83-1 . . . gaacaaaattagagaataacaatgcaaaca
BBa_K3702153BIOFAB Terminator apFAB368TerminatorBIOFAB96-1 . . . gcgcggttgataacggttcagacaggttta
BBa_K3702154BIOFAB Terminator apFAB369TerminatorBIOFAB106-1 . . . cagccgtatgacaaggtcggcatcaggtgt
BBa_K3702155BIOFAB Terminator apFAB370TerminatorBIOFAB97-1 . . . gcgcggttgataacggttcagacaggttta
BBa_K3702156BIOFAB Terminator apFAB371TerminatorBIOFAB93-1 . . . cccccgatgtggcgcagactgatttatcac
BBa_K3702157BIOFAB Terminator apFAB372TerminatorBIOFAB91-1 . . . gggggagagggaagtcatgaaaaaactaac
BBa_K3702158BIOFAB Terminator apFAB373TerminatorBIOFAB84-1 . . . attactcaacaggtaaggcgcgaggttttc
BBa_K3702159BIOFAB Terminator apFAB374TerminatorBIOFAB104-1 . . . ttgggtcagtcgtataaaggtcattacgga
BBa_K3702160BIOFAB Terminator apFAB375TerminatorBIOFAB80-1 . . . tcccgatcttaatgaatggccggaagtggt
BBa_K3702162BIOFAB Terminator apFAB377TerminatorBIOFAB91-1 . . . gggggagagggaagtcatgaaaaaactaac
BBa_K3702163BIOFAB Terminator apFAB378TerminatorBIOFAB91-1 . . . caagcagcagattacgcgcagaaaaaaagg
BBa_K3702164BIOFAB Terminator apFAB379TerminatorBIOFAB85-1 . . . gaacaaaattagagaataacaatgcaaaca
BBa_K3702165BIOFAB Terminator apFAB380TerminatorBIOFAB85-1 . . . gaacaaaattagagaataacaatgcaaaca
BBa_K3702166BIOFAB Terminator apFAB381TerminatorBIOFAB90-1 . . . ttccgggcattaaccctcactaacaggaga
BBa_K3702167BIOFAB Terminator apFAB382TerminatorBIOFAB87-1 . . . gaacaaaattagagaataacaatgcaaaca
BBa_K3702168BIOFAB Terminator apFAB383TerminatorBIOFAB88-1 . . . tttataaggagacactttatgtttaagaag
BBa_K3702169BIOFAB Terminator apFAB384TerminatorBIOFAB91-1 . . . atctgttgtttgtcggtgaacgctctcctg
BBa_K3702170BIOFAB Terminator apFAB385TerminatorBIOFAB87-1 . . . gaacaaaattagagaataacaatgcaaaca
BBa_K3702171BIOFAB Terminator apFAB386TerminatorBIOFAB85-1 . . . ggagattttcaacatgaaaaaattattatt
BBa_K3702172BIOFAB Terminator apFAB387TerminatorBIOFAB91-1 . . . atctgttgtttgtcggtgaacgctctcctg
BBa_K3702174BIOFAB Terminator apFAB389TerminatorBIOFAB91-1 . . . atctgttgtttgtcggtgaacactctcccg
BBa_K3702175BIOFAB Terminator apFAB390TerminatorBIOFAB89-1 . . . gaccttaaaaacataaccgaggagcagaca
BBa_K3702176BIOFAB Terminator apFAB391TerminatorBIOFAB82-1 . . . tttggaggggcagaaagatgaatgactgtc