Difference between revisions of "Part:BBa K3982005:Design"

 
(→‎Design Notes)
 
(2 intermediate revisions by the same user not shown)
Line 7: Line 7:
  
 
===Design Notes===
 
===Design Notes===
−
None
+
The scaffold region has been designed as referred from Ref. 1. It consists of the tracrRNA and some regions of crRNA. The guiding region is the 20 bp spacer sequence which is complementary to the mutant katG gene in Mtb and referred from Ref 2. The mutation appears at base number 11 (agc → acc) of the spacer (guiding) sequence. This is the S315T mutation in Mtb genome (refer Ref 3).
  
 +
Refer to the wildtype katG targeting sgRNA here  - [https://parts.igem.org/Part:BBa_K3982004 BBa_K3982004]
  
 +
The 20 bp spacer sequence is as follows: gcgatcaccaccggcatcga
  
 
===Source===
 
===Source===
−
 
−
NCBI Reference Sequence: NC_000962.3
 
−
Reference: L. B. Harrington et al. Science 10.1126/science.aav4294 (2018).
 
  
  
 
===References===
 
===References===
 +
1) Kim, D.Y., Lee, J.M., Moon, S.B. et al. Efficient CRISPR editing with a hypercompact Cas12f1 and engineered guide RNAs delivered by adeno-associated virus. Nat Biotechnol (2021). https://doi.org/10.1038/s41587-021-01009-z
 +
 +
2) NCBI Reference Sequence for Mycobacterium tuberculosis H37Rv: NC_000962.3
 +
 +
3) Musser, J. M., Kapur, V., Williams, D. L., Kreiswirth, B. N., van Soolingen, D., & van Embden, J. D. (1996). Characterization of the catalase-peroxidase gene (katG) and inhA locus in isoniazid-resistant and -susceptible strains of Mycobacterium tuberculosis by automated DNA sequencing: restricted array of mutations associated with drug resistance. The Journal of infectious diseases, 173(1), 196–202. https://doi.org/10.1093/infdis/173.1.196

Latest revision as of 15:10, 21 October 2021


CODE M sgRNA for targeting mutant katG gene in Mycobacterium tuberculosis


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]


Design Notes

The scaffold region has been designed as referred from Ref. 1. It consists of the tracrRNA and some regions of crRNA. The guiding region is the 20 bp spacer sequence which is complementary to the mutant katG gene in Mtb and referred from Ref 2. The mutation appears at base number 11 (agc → acc) of the spacer (guiding) sequence. This is the S315T mutation in Mtb genome (refer Ref 3).

Refer to the wildtype katG targeting sgRNA here - BBa_K3982004

The 20 bp spacer sequence is as follows: gcgatcaccaccggcatcga

Source

References

1) Kim, D.Y., Lee, J.M., Moon, S.B. et al. Efficient CRISPR editing with a hypercompact Cas12f1 and engineered guide RNAs delivered by adeno-associated virus. Nat Biotechnol (2021). https://doi.org/10.1038/s41587-021-01009-z

2) NCBI Reference Sequence for Mycobacterium tuberculosis H37Rv: NC_000962.3

3) Musser, J. M., Kapur, V., Williams, D. L., Kreiswirth, B. N., van Soolingen, D., & van Embden, J. D. (1996). Characterization of the catalase-peroxidase gene (katG) and inhA locus in isoniazid-resistant and -susceptible strains of Mycobacterium tuberculosis by automated DNA sequencing: restricted array of mutations associated with drug resistance. The Journal of infectious diseases, 173(1), 196–202. https://doi.org/10.1093/infdis/173.1.196