Difference between revisions of "Part:BBa K3806020"

 
 
(5 intermediate revisions by the same user not shown)
Line 3: Line 3:
 
<partinfo>BBa_K3806020 short</partinfo>
 
<partinfo>BBa_K3806020 short</partinfo>
  
prov
+
The TU Delft iGEM 2021 project <html><a href="https://2021.igem.org/Team:TUDelft"><b>AptaVita</b></a></html> looks at developing a modular, quantitative, and accessible rapid diagnostic test for vitamin deficiencies. In this project, vitamin-specific aptazyme biosensors are engineered through a novel <html><i>in vitro</i></html> evolution method, <html><i>De novo</i></html> Rapid <html><i>In vitro</i></html> Evolution of RNA biosensors (DRIVER) [1]. Range <HTML><a href="https://parts.igem.org/Part:BBa_K3806017" target="_blank"><b>BBa_K3806017</b></a></HTML> - <HTML><a href="https://parts.igem.org/Part:BBa_K3806021" target="_blank"><b>BBa_K3806021</b></a></HTML> [1] is a set of primers designed to assist the DRIVER selection process.
 
+
<!-- Add more about the biology of this part here
+
===Usage and Biology===
+
  
 
<!-- -->
 
<!-- -->
Line 12: Line 9:
 
<partinfo>BBa_K3806020 SequenceAndFeatures</partinfo>
 
<partinfo>BBa_K3806020 SequenceAndFeatures</partinfo>
  
 +
 +
 +
==Usage and Biology==
 +
<HTML><h3>DRIVER</h3></html>
 +
Starting with a high-diversity library of potential biosensors, DRIVER makes use of a regeneration strategy within a directed-evolution procedure. This grants the selection of sequences that present a higher level of cleavage in the absence of ligand and a lower level of cleavage in the presence of ligand. During rounds in which the ligand(s) are present (also referred to as uncleavage selection rounds), the uncleaved RNA molecules preserve an unmodified 5’ prefix sequence from the previous round. These sequences are PCR amplified using this prefix and a specific suffix as primers. During rounds in which the target ligand(s) are absent (cleavage rounds), RNA molecules that undergo self-cleavage are regenerated by addition of a different 5’ prefix. Afterwards, these sequences are PCR amplified using the newly added prefix and the specific suffix as primers. By iteratively applying this process, each round selectively enriches the desired subset of sequences from the library. Eventually, RNA sequences whose cleavage is regulated by the target ligand(s) dominate the population.
 +
 +
 +
<HTML><u><b>BBa_K3806020 in DRIVER</b></u></html>
 +
 +
To allow for prefix replacement in cleavage selection rounds, two prefix sequences are required, named X prefix and Z prefix. <HTML><a href="https://parts.igem.org/Part:BBa_K3806020" target="_blank"><b>BBa_K3806020</b></a></HTML>  is used as the forward primer to amplify sequences with the W prefix.
 +
 +
Sequence: 5’ AATTTAATACGACTCACTATAGGGAAACAAACAAAGCTG 3’
 +
 +
 +
==References==
 +
<html>
 +
<style>
 +
ol li {
 +
counter-increment: OrderedList;
 +
list-style: none;
 +
}
 +
ol li :before {
 +
content: "[" counter(OrderedList) "]";
 +
}
 +
</style>
 +
 +
<ol>
 +
 +
<li>
 +
[1]Townshend, B., Xiang, J. S., Manzanarez, G., Hayden, E. J. and Smolke, C. (2021). A multiplexed, automated evolution pipeline enables scalable discovery and characterization of biosensors. Nat Commun, 12, 1437.
 +
</li>
 +
 +
</ol>
 +
</html>
  
 
<!-- Uncomment this to enable Functional Parameter display  
 
<!-- Uncomment this to enable Functional Parameter display  

Latest revision as of 13:55, 21 October 2021


PCR forward primer for W prefix (DRIVER)

The TU Delft iGEM 2021 project AptaVita looks at developing a modular, quantitative, and accessible rapid diagnostic test for vitamin deficiencies. In this project, vitamin-specific aptazyme biosensors are engineered through a novel in vitro evolution method, De novo Rapid In vitro Evolution of RNA biosensors (DRIVER) [1]. Range BBa_K3806017 - BBa_K3806021 [1] is a set of primers designed to assist the DRIVER selection process.

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]


Usage and Biology

DRIVER

Starting with a high-diversity library of potential biosensors, DRIVER makes use of a regeneration strategy within a directed-evolution procedure. This grants the selection of sequences that present a higher level of cleavage in the absence of ligand and a lower level of cleavage in the presence of ligand. During rounds in which the ligand(s) are present (also referred to as uncleavage selection rounds), the uncleaved RNA molecules preserve an unmodified 5’ prefix sequence from the previous round. These sequences are PCR amplified using this prefix and a specific suffix as primers. During rounds in which the target ligand(s) are absent (cleavage rounds), RNA molecules that undergo self-cleavage are regenerated by addition of a different 5’ prefix. Afterwards, these sequences are PCR amplified using the newly added prefix and the specific suffix as primers. By iteratively applying this process, each round selectively enriches the desired subset of sequences from the library. Eventually, RNA sequences whose cleavage is regulated by the target ligand(s) dominate the population.


BBa_K3806020 in DRIVER

To allow for prefix replacement in cleavage selection rounds, two prefix sequences are required, named X prefix and Z prefix. BBa_K3806020 is used as the forward primer to amplify sequences with the W prefix.

Sequence: 5’ AATTTAATACGACTCACTATAGGGAAACAAACAAAGCTG 3’


References

  1. [1]Townshend, B., Xiang, J. S., Manzanarez, G., Hayden, E. J. and Smolke, C. (2021). A multiplexed, automated evolution pipeline enables scalable discovery and characterization of biosensors. Nat Commun, 12, 1437.