Difference between revisions of "Part:BBa K754000"

Latest revision as of 12:26, 20 October 2021

S. elongatus PCC7942 psbAI promoter

Our part is the Synechococcus elongatus promoter for gene psbAI. This promoter works on a constitutive way, althought its activity can be enhanced or decreased in the presence or absence of light (in nature it works regulated in a circadian cicle). This part is suitable for building light-induced devices.

Sequence and Features

Usage and Biology

The psbAI gene of the cyanobacterium Synechococcus elongatus PCC 7942 is one of three psbA genes that encode a critical photosystem II reaction center protein, D1. Regulation of the gene family in response to changes in the light environment is complex, occurs at transcriptional and posttranscriptional levels, and results in an interchange of two different forms of D1 in the membrane. Expression of psbAI is downregulated under high-intensity light (high light) in contrast to induction of the other two family members.

Cyanobacteria, as well as algae and higher plants, carry out oxygenic photosynthesis, which requires multiprotein complexes that driven by solar energy produce reducing power (NADPH) and chemical energy (ATP). In this system water is the source of electrons in reducing C02 to various organic compounds. The PSII is involved in the water oxidation reaction and the release of oxygen and its core is composed of two critical proteins D1 and D2, which coordinate the cofactors of light-driven charge separation (Andersson and Styring, 1991). Due to the strong oxidative chemistry of the PSII, the D1 protein is subjected to constant photooxidation stress and therefore requires regular replacement to guarantee a steady-state level of D1 protein under different environmental conditions. Under low light growth, the rate of replenishment is 5h, while under intense illumination, the protein is replaced every 20 minutes (Tyystjärvi et al. 1994). In cyanobacteria the three psbA genes that encode the D1 protein are under strict regulation to guarantee the proper functioning of the PSII. In Synechococcus elongatus PCC7942 this three genes encode two distinct D1 protein isoforms: D1:1 being encoded by psbAI and D1:2 by psbAII and psbAIII (Golden et al. 1986).

Functional Parameters

One of the most crucial determinants of gene expression in cyanobacteria is the initiation of transcription, where several sigma factors are involved in promoter recognition (Mulo et al. 2009). The psbAI promoter has characteristic -35 spaced elements from the E. coli σ70 promoter, but has an atypical -10bp element TCTCCT (Golden et al. 1986) (figure 3), which entails that this promoter doesn't work in E. coli (Schaefer and Golden, 1989) making it difficult to characterize it properly. The smallest psbAI functional promoter region comprises nucleotides -54 to +1, and one or more proteins bind specifically to the psbAI upstream region stimulating, rather than inactivating the transcription (+1 to + 43) (Nair et al. 2001), unlike typical σ70 promoters. A segment of approximately 20bp of the consensus -35 element has been shown to be implicated in both, promoter activation per se and light-responsive expression, this region is characterized by being AT-rich (Nair et al. 2001).

Behaviour

Some studies show that psbAI transcript is actively destabilized when shift to high light (Kulkarni et al. 1992) (figure 4, 5 and 6), but prolonged exposure of S. elongatus PCC 7942 cells to high light leads to an increased accumulation of all psbA transcripts, including psbAI (Kulkarni and Golden, 1994). This is an electronic flow independent response implying a response to light rather than to redox changes (Tsinoremas et al. 1996). Extensive assays suggest that the psbAI promoter in S. elongatus is among the strongest in this organism (Andersson et al. 2000). If you would like to use this part in Synechococcus elongatus PCC7942 you should be aware that the transformation of S. elongatus is based on homologous recombination between two sites on the chromosome (neutral sites) that have been developed as cloning loci. Ectopic sequences can be homologous recombinant without any apparent aberrant phenotype (Clerico et al. 2007). Thus, to use this part you should clone it within the S. elongatus neutral sites sequences and incorporate it into the cyanobacterial chromosome. When transforming, the selective marker and the part of interest flanked with the neutral site sequences are inserted into the neutral site of S. elongatus chromosome and the backbone is lost.

How to use this part

Transforming S. elongatus PCC7942 for promoter characterization:

Our main objective has been to characterize the psbAI promoter (Submitted parts) of Synechococcus elongatus PCC7942 in order to know more about its operation and understand how this promoter would control our final construct ( Designed parts) to have a diel switch of AHL, the signal molecule for our Aliivibrio fischeri population to glow.

To characterize this promoter we had two options: making psbAIp::lacZ fusions and monitored the β-galactosidase activity or making psbAIp::luxABCDE fusions and monitored the bioluminescence produced as a result of the promoter activation. We refused to use a psbAIp::lacZ fusion because some assays report that the psbAI promoter response to light cannot be properly monitored by the β-galactosidase activity (Nair et al. 2001). For this reason we choosed using vector fusions. With this aim, we cloned several fusion plasmids (pAM977 and pAM2195) in Escherichia coli and transformed them into S. elongatus, both wildtype and cscB strain. The fusion vectors were provided by Susan Golden´s lab.

Cloning into E. coli

We successfully cloned all the vectors in DH5α E. coli strains. For E. coli transformation we used this protocol (link). For the selective selection for pAM977 we used ampicillin (1μl/ml) and for pAM2195 Chloramphenicol (0.7μl/ml). The lack of spectrophotometer or other apparatus to measure optical density in our lab impede us to determine the concentration of our vectors.

Transforming Coccus

Once cloned we transformed a wild type strain provided from the Physiology, Genetic and Microbiology departments of University of Alicante and the cscB strain provided from the Wyss Institute in Harvard. As the cscB strain from Harvard was resistant to Cm, we only could transform it with the pAM977 plasmid, which gives Sp resistance. Wildtype was transformed with both plasmids (pAM977 and pAM2195). We used the following protocol to transform Synechococcus:

<"">

Protocol

Extracted from Clerico et al. 2007:

-We grew 100ml of cscB and WT in BG-11 liquid medium (see how we grown them and our recipe here) shaking at 250rpm with constant light we used cold light fluorescent tubes. Cells had an optical density at 750nm (OD750) of 0.7, which is reach in 4 to 7 days approximately.

-We collected 15mL of the culture and centrifuge it at 6000g for 10 min and discarded the supernatant.

-We resuspended collected cells in 10 mL of 10mM NaCl and centrifuge them again at 6000g for 10 min.

-After it, we resuspended the pellet in 0.3mL of BG-11M liquid medium.

-We added 2μl of pAM2195 and pAM977 after doing a Miniprep of the clonation with a JetQuick kit.

Wrap tubes in aluminum foil to keep out light and incubate at 30oC for 15 to 20h with gentle agitation.

-And then, plate the entire 0.3mL cell suspension on BG-11 medium agar (see here the recipe) with the selective antibiotics. We used this concentration: 2μg/ml spectinomycin and 7.5μg/mL of chloramphenicol. After 7 to 10 days of incubation under standard light conditions transformed colonies should appear.

-After colonies appearance pick single transformants and grow them on fresh liquid BG-11M agar plate with selective antibiotic (this is done to ensure that all colonies have incorporated the trans gene as S. elongatus has multiple copies of its chromosome).

-After 5 to 7 days of growth, cyanobacteria can be used to inoculate a BG-11 liquid culture with the selective antibiotic.

Results

We weren´t able to obtain transformants with the wild type strain of S. elongatus. But we obtained resistant colonies to Sp of the cscB strain transformed with the pAM977 vector. This was achieved the last week of lab work, so due to the slowly growth rate of S. elongatus, we haven´t have the time to grow the transformants in liquid medium and start with the bioluminescence measures to characterize the promoter. However, we will try to have some results for the Jamboree concerning this part.

psbA1 activity in novel chassis S. elongatus UTEX 2973

IISER-Pune-India 2021:

psbA1 is a constitutive promoter found in S. elongatus, among other cyanobacteria species. The psbA1 promoter from the strain S. elongatus PCC 7942 and from S. elongatus UTEX 2973 share a 100% sequence identity (verified by NCBI BLAST search).

Sequence of psbA1 from S. elongatus UTEX 2973 [1]:

ATCGATCTTGAGGTTGTAAAGGGCAAGAGTCTTAGTTAAAAACTCTTGCTTTTTAGGCTAGGAGATTAA CTGTCAAAAAGGTGTAAAAAACCCTTAATTTTTAGCTAAGTAGACACTATTTTTATGTAACGAAAACTTT GTGAATTTATGTAATGTTTAGAGCGATCGCCCAAGGCTACAGTGCTCAACGGAGCCAAAACTACTGTCTA CACTGGATTAGAAGACGCTAAATCCAG

Shubin Li et al., characterised and compared the activity of various constitutive promoters in S. elongatus UTEX 2973, including psbA1, native to S. elongatus UTEX 2973 [1]. The characterisation was done at both high and low light intensities - 500 umol photons/m2/s and 50 umol photons/m2/s respectively - using the reporter gene lacZ, encoding beta-galactosidase.

The activity of beta-galactosidase was calculated using Miller value (Miller = 1000 × OD420 nm/(total volume of the cell culture × reaction time × OD750 nm of the cell)). Transcriptional expression of lacZ was measured using qRT-PCR.

Promoter-lacZ-trbcL constructs, flanked by Neutral Site 1 homology arms, were made on a pBR322 backbone vector (see fig. b). The pBR322 backbone contains an oriT/bom site, allowing it to be introduced into UTEX 2973 by conjugation. The Neutral Site 1 homology arms allow for genomic integration of the Promoter-lacZ-trbcL construct into the Neutral Site 1 on UTEX 2973's genome via homologous recombination following conjugation.

Constitutive promoters characterised in UTEX 2973 by Shubin Li et al.:

a. psbA1, psbA2, psbA3, cpcB1, cpcB2 from UTEX 2973

b. cpc560 and psbA2 from Synechocystis PCC 6803

c. lac from E. coli

d. trc, LlacO-1, psbA from the chloroplast of Amaranthus hybridus

Their results indicate that psbA1 is weaker than most other commonly used constitutive promoters in S. elongatus at high light intensities.

Beta-glactosidase had lower activity under psbA1 than commonly used constitutive promoters psbA2, psbA3, cpcB1, cpcB2, cpc560 promoters (see fig. a) at high light intensity. The transcriptional expression of lacZ under psbA1 is lower than that of lacZ under cpcB1, cpc560, psbA3 promoters (see fig. a) at high light intensity.

psbA1 shows nearly the same strength under both high and low light conditions (see fig. c).

Characterisation of promoter strength in S. elongatus UTEX 2973. a. beta-galactosidase activity and qRT-PCR analsyis of lacZ under various constitutive promoters at high light condition of 500 umol photons/m2/s. b. diagram of integrative vector containing promoter-lacZ-trbcL construct. c. beta-galactosidase activity under various constitutive promoters at high light condition of 500 umol photons/m2/s and low light light condition of 50 umol photons/m2/s. Figure adapted from Shubin Li et al. (2018) [1]

References

Atsumi, S., Higashide, W., and Liao, J. C. (2009) Direct photosynthetic recycling of carbon dioxide to isobutyraldehyde. Nat Biotechnol. 27:1177-1180

Clerico, E. M., Ditty, J. L. & Golden, S.S. (2007) Specialized Techniques for Site-Directed Mutagenesis in Cyanobacteria. Methods in Molecular Biology. 362:153–172.

Wang, B., Wang J., Zhang, W. & Meldrum, D. R. (2012) Application of Synthetic Biology in cyanobacteria and algae. Frontiers in Microbiology. doi: 10.3389/fmicb.2012.00344

Clerico, Eugenia M., Ditty, Jayna L., Golden, S.S. (2007) Specialized Techniques for Site-Directed Mutagenesis in Cyanobacteria. Methods in Molecular Biology. 362:153–172.

Golden, S. S., Brusslan, J. & Haselkorn, R. (1986) Expression of a family of psbA genes encoding a photosystem II polypeptide in the cyanobacterium Anacystis nidulans R2. EMBO J., 5:2789–98.

Golden, S. S. (1995) Light-Responsive Gene Expression in Cyanobacteria. J. Bacteriology, 177:1651–1654.

Kulkarni, R. D. & Golden, S. S. (1995) Form II of D1 is important during transition from standard to high light intensity in Synechococcus sp. strain PCC 7942. Photosyn. Res. 46:435–443.

Kulkarni, R. D., Schaefer, M. R. & Golden, S. S. (1992) Transcriptional and posttranscriptional components of psbA response to high light intensity in Synechococcus sp. strain PCC 7942. J. Bacteriol. 174:3775–3781.

Mackey, S.R., Ditty, M.J., Clerico, M. E. & Golden, S. S. (2007) Detection of rhythmic bioluminescence from luciferase reporters in cyanobacteria. Methods in Molecular Biology, 362:115–29.

Mulo, P., Sakurai, I. & Aro, E. M. (2012) Strategies for psbA gene expression in cyanobacteria, green algae and higher plants: from transcription to PSII repair. Biochimica et biophysica acta, 1817:247–57.

Mulo, P., Sicora, C. & Aro, E.M. (2009) Cyanobacterial psbA gene family: optimization of oxygenic photosynthesis. Cellular and molecular life sciences : CMLS, 66:3697–710.

Nair, U., Thomas, C. & Golden, S. S. (2001) Functional Elements of the Strong psbAI Promoter of Synechococcus elongatus PCC 7942. J. Bacteriology, 183:1740–1747.

Schaefer, M.R. & Golden, S. S. (1989) Light availability influences the ratio of two forms of D1 un cyanobacterial thylakoids. J. Biol. Chem, 264:7412–7417.

Schmitz, O., Tsinoremas N. F., Anandan, S. & Golden, S. S. (1999) General effect of photosynthetic electron transport inhibitors on translation precludes their use for investigating regulation of D1 biosynthesis in Synechococcus sp. strain PCC 7942. Photosyn. Res. 62:261–271.

Tsinoremas, N. F., Schaefer, M- R & Godel, S. S. (1994) Blue and Red Light Reversibly Control psbA Expression in the Cyanobacterium Synechococcus sp. Strain PCC7942. J. Biol. Chem, 269:16143–16147.

Tsinoremas, N. F., Ishiura, M., Kondo, T., Andersson, C. R., Tanaka, K., Takahashi, C. H., Johnson, C. H. & Goldem, S. S. (1996) A sigma factor that modifies the circadian expression of a subset of genes in cyanobacteria. EMBO J. 15:2488–2495.

Tsinoremas, N. F., Kawakami, A. & Christopher, D. A. (1999) High-fluence blue light stimulates transcription from a higher plant chloroplast psbA promoter expressed in a cyanobacterium Synechococcus (sp. strain PCC7942). Plant cell Phys., 40:448–52.

Tyystjärvi, T., Aro, E. M., Jansson, C., Mäenpää , P. (1994) Changes of amino acid sequence in PEST-like area and QEEET motif affect degradation rate of D1 polypeptide in photosystem II. Plant Mol. Biol. 25:517–526.

[1] Li, S., Sun, T., Xu, C., Chen, L., & Zhang, W. (2018). Development and optimization of genetic toolboxes for a fast-growing cyanobacterium Synechococcus elongatus UTEX 2973. Metabolic engineering, 48, 163-174