Difference between revisions of "Part:BBa K3799003"

Line 25: Line 25:
 
===Cloning and expression===
 
===Cloning and expression===
  
The coding sequence for DNaseI was initially found from NCBI and then procured synthetically adding biobrick prefix and suffix from TwistBioscience.Cloning was carried out following Normal biobrick assembly using combination of EcoRI and PstI.Linearized plasmid nack bone of PSBIC3 obtained by PCR amplification using Plasmid specific primers and Gene fragment were digested with EcoRI and PstI and further ligated .The resultant plasmid was transformed into Ecoli DH5α.Transformed colonies were identified and further confirmed using colony PCR.
+
The coding sequence for DNaseI was initially found from NCBI and then procured synthetically adding biobrick prefix and suffix from TwistBioscience.Cloning was carried out following Normal biobrick assembly using combination of EcoRI and PstI.Linearized plasmid back bone of PSBIC3 obtained by PCR amplification using Plasmid specific primers and Gene fragment were digested with EcoRI and PstI and further ligated .The resultant plasmid was transformed into Ecoli DH5α.Transformed colonies were identified and further confirmed using colony PCR and insert release check.
 +
 
 +
Primers used
 +
 
 +
Biobrick Forward- gatggaattcgcggccgcttctag
 +
Biobrick reverse- gatgctgcagcggccgctactagta
 +
 
 +
Plasmid backbone forward- gctgcagtccggcaaaaaa
 +
Plasmid backbone reverse- gtgaattccagaaatcatccttagcg
 +
 
 +
Sequencing forward- tgccacctgacgtctaagaa
 +
Sequencing reverse- attaccgcctttgagtgagc

Revision as of 10:56, 20 October 2021


Dnase I with promoter(R0010) , RBS(B0034), Terminator(B0015)

This part is used produce Bovine pancreatic DNaseI(BBa_K3799002) under IPTG inducible Ecoli promoter(ROO10) aalong with RBS(B0034) and double terminator(B0015)

Usage and Biology

Bovine pancreatic DNase I is a double-strand specific endonuclease that degrades DNA. Bovine pancreatic deoxyribonuclease I (DNase I) is a DNA minor grove-interacting nuclease, which shows relatively low specificity.Bovine pancreatic deoxyribonuclease I (bpDNase) cleaves double-stranded DNA with no sequence specificity making it suitable for degradation of bacterial biofilm.Deoxyribonuclease I (DNase I) enzymes cleave single or double-stranded DNA and require divalent metal ions to hydrolyze DNA yielding 3΄-hydroxyl and 5΄-phosphorylated products

Sequence and Features



Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]


Plasmid composition

Cloning and expression

The coding sequence for DNaseI was initially found from NCBI and then procured synthetically adding biobrick prefix and suffix from TwistBioscience.Cloning was carried out following Normal biobrick assembly using combination of EcoRI and PstI.Linearized plasmid back bone of PSBIC3 obtained by PCR amplification using Plasmid specific primers and Gene fragment were digested with EcoRI and PstI and further ligated .The resultant plasmid was transformed into Ecoli DH5α.Transformed colonies were identified and further confirmed using colony PCR and insert release check.

Primers used

Biobrick Forward- gatggaattcgcggccgcttctag Biobrick reverse- gatgctgcagcggccgctactagta

Plasmid backbone forward- gctgcagtccggcaaaaaa Plasmid backbone reverse- gtgaattccagaaatcatccttagcg

Sequencing forward- tgccacctgacgtctaagaa Sequencing reverse- attaccgcctttgagtgagc