Difference between revisions of "Part:BBa K3799003"
Line 25: | Line 25: | ||
===Cloning and expression=== | ===Cloning and expression=== | ||
− | The coding sequence for DNaseI was initially found from NCBI and then procured synthetically adding biobrick prefix and suffix from TwistBioscience.Cloning was carried out following Normal biobrick assembly using combination of EcoRI and PstI.Linearized plasmid | + | The coding sequence for DNaseI was initially found from NCBI and then procured synthetically adding biobrick prefix and suffix from TwistBioscience.Cloning was carried out following Normal biobrick assembly using combination of EcoRI and PstI.Linearized plasmid back bone of PSBIC3 obtained by PCR amplification using Plasmid specific primers and Gene fragment were digested with EcoRI and PstI and further ligated .The resultant plasmid was transformed into Ecoli DH5α.Transformed colonies were identified and further confirmed using colony PCR and insert release check. |
+ | |||
+ | Primers used | ||
+ | |||
+ | Biobrick Forward- gatggaattcgcggccgcttctag | ||
+ | Biobrick reverse- gatgctgcagcggccgctactagta | ||
+ | |||
+ | Plasmid backbone forward- gctgcagtccggcaaaaaa | ||
+ | Plasmid backbone reverse- gtgaattccagaaatcatccttagcg | ||
+ | |||
+ | Sequencing forward- tgccacctgacgtctaagaa | ||
+ | Sequencing reverse- attaccgcctttgagtgagc |
Revision as of 10:56, 20 October 2021
Dnase I with promoter(R0010) , RBS(B0034), Terminator(B0015)
This part is used produce Bovine pancreatic DNaseI(BBa_K3799002) under IPTG inducible Ecoli promoter(ROO10) aalong with RBS(B0034) and double terminator(B0015)
Usage and Biology
Bovine pancreatic DNase I is a double-strand specific endonuclease that degrades DNA. Bovine pancreatic deoxyribonuclease I (DNase I) is a DNA minor grove-interacting nuclease, which shows relatively low specificity.Bovine pancreatic deoxyribonuclease I (bpDNase) cleaves double-stranded DNA with no sequence specificity making it suitable for degradation of bacterial biofilm.Deoxyribonuclease I (DNase I) enzymes cleave single or double-stranded DNA and require divalent metal ions to hydrolyze DNA yielding 3΄-hydroxyl and 5΄-phosphorylated products
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]
Plasmid composition
Cloning and expression
The coding sequence for DNaseI was initially found from NCBI and then procured synthetically adding biobrick prefix and suffix from TwistBioscience.Cloning was carried out following Normal biobrick assembly using combination of EcoRI and PstI.Linearized plasmid back bone of PSBIC3 obtained by PCR amplification using Plasmid specific primers and Gene fragment were digested with EcoRI and PstI and further ligated .The resultant plasmid was transformed into Ecoli DH5α.Transformed colonies were identified and further confirmed using colony PCR and insert release check.
Primers used
Biobrick Forward- gatggaattcgcggccgcttctag Biobrick reverse- gatgctgcagcggccgctactagta
Plasmid backbone forward- gctgcagtccggcaaaaaa Plasmid backbone reverse- gtgaattccagaaatcatccttagcg
Sequencing forward- tgccacctgacgtctaagaa Sequencing reverse- attaccgcctttgagtgagc