Difference between revisions of "Part:BBa K3868096"

 
 
(2 intermediate revisions by the same user not shown)
Line 5: Line 5:
 
pTarget-8G plasmids contains pj23119 and sgRNA-8G etc, which can target the RBS sequence of T7RNAP for Cas9 expression.
 
pTarget-8G plasmids contains pj23119 and sgRNA-8G etc, which can target the RBS sequence of T7RNAP for Cas9 expression.
  
−
<!-- Add more about the biology of this part here
 
−
===Usage and Biology===
 
−
 
−
<!-- -->
 
 
<span class='h3bb'>Sequence and Features</span>
 
<span class='h3bb'>Sequence and Features</span>
 
<partinfo>BBa_K3868096 SequenceAndFeatures</partinfo>
 
<partinfo>BBa_K3868096 SequenceAndFeatures</partinfo>
  
 +
 +
 +
===Usage and Biology===
 +
 +
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;To achieve the editing of the RBS sequence using CBE, a tailored RBS sequence of 5'-GGGGGGGG-3' was integrated into the corresponding site of the T7 RNAP, yielding a starting strain of BL21 (DE3)-RBS8G. Here, the CRISPR/Cas9 system was used to construct the BL21 (DE3)-RBS8G strain. The pCas and pTarget plamids was provided by our PI, Xiao-Man Sun. In the genome of BL21 (DE3), the CCGGATTTACTAACTGGAAG was chosen as N20 sequence, and then the pTarget-8G plasmid was successfully constructed based on the pTarget (Fig. 1).
 +
<html>
 +
<div align="center">
 +
    <figure>
 +
        <img src="https://2021.igem.org/wiki/images/d/db/T--NNU-China--part-engineeringsuccess1.png" width="60%" style="float:center">
 +
        <figcaption>
 +
        <p style="font-size:1rem">
 +
        </p>
 +
        </figcaption>
 +
    </figure>
 +
</div>
 +
</html>
 +
<div align="center">
 +
:'''Fig 1. The Schematic diagram of pCas, pTarget, and the composite part of <partinfo>BBa_K3868095 </partinfo> and <partinfo>BBa_K3868096 </partinfo> '''
 +
</div>
 +
===Results===
 +
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; By sequencing, the RBS sequence of T7RNAP on the genome was successfully replaced by GGGGGGGG (Fig. 2), which indicated that the starting strain BL21 (DE3)-RBS8G was successfully constructed. 
 +
 +
<html>
 +
<div align="center">
 +
    <figure>
 +
        <img src="https://2021.igem.org/wiki/images/5/5f/T--NNU-China--part-engineeringsuccess2.png" width="60%" style="float:center">
 +
        <figcaption>
 +
        <p style="font-size:1rem">
 +
        </p>
 +
        </figcaption>
 +
    </figure>
 +
</div>
 +
</html>
 +
<div align="center">
 +
:'''Fig 2. The sequencing results of the RBS sequence of T7RNAP on the genome in the BL21 (DE3) and BL21 (DE3)-RBS8G strain. '''
 +
</div>
 +
 +
<p><b><h2>Reference</h2></b></p>
 +
<p>1. Wang Y, Cheng H, Liu Y, Wen X, Zhang K, Ma Y. In-situ generation of large numbers of genetic combinations for metabolic reprogramming via CRISPR-guided base editing. Nature communications. 2021; 12(1): 1-12.
  
 
<!-- Uncomment this to enable Functional Parameter display  
 
<!-- Uncomment this to enable Functional Parameter display  

Latest revision as of 11:52, 19 October 2021


pTarget-8G

pTarget-8G plasmids contains pj23119 and sgRNA-8G etc, which can target the RBS sequence of T7RNAP for Cas9 expression.

Sequence and Features


Assembly Compatibility:
  • 10
    INCOMPATIBLE WITH RFC[10]
    Illegal EcoRI site found at 182
    Illegal XbaI site found at 188
    Illegal SpeI site found at 73
    Illegal PstI site found at 200
  • 12
    INCOMPATIBLE WITH RFC[12]
    Illegal EcoRI site found at 182
    Illegal NheI site found at 7
    Illegal NheI site found at 30
    Illegal NheI site found at 50
    Illegal SpeI site found at 73
    Illegal PstI site found at 200
  • 21
    INCOMPATIBLE WITH RFC[21]
    Illegal EcoRI site found at 182
    Illegal BglII site found at 212
    Illegal XhoI site found at 236
  • 23
    INCOMPATIBLE WITH RFC[23]
    Illegal EcoRI site found at 182
    Illegal XbaI site found at 188
    Illegal SpeI site found at 73
    Illegal PstI site found at 200
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal EcoRI site found at 182
    Illegal XbaI site found at 188
    Illegal SpeI site found at 73
    Illegal PstI site found at 200
  • 1000
    COMPATIBLE WITH RFC[1000]


Usage and Biology

        To achieve the editing of the RBS sequence using CBE, a tailored RBS sequence of 5'-GGGGGGGG-3' was integrated into the corresponding site of the T7 RNAP, yielding a starting strain of BL21 (DE3)-RBS8G. Here, the CRISPR/Cas9 system was used to construct the BL21 (DE3)-RBS8G strain. The pCas and pTarget plamids was provided by our PI, Xiao-Man Sun. In the genome of BL21 (DE3), the CCGGATTTACTAACTGGAAG was chosen as N20 sequence, and then the pTarget-8G plasmid was successfully constructed based on the pTarget (Fig. 1).

Fig 1. The Schematic diagram of pCas, pTarget, and the composite part of BBa_K3868095 and BBa_K3868096

Results

         By sequencing, the RBS sequence of T7RNAP on the genome was successfully replaced by GGGGGGGG (Fig. 2), which indicated that the starting strain BL21 (DE3)-RBS8G was successfully constructed.

Fig 2. The sequencing results of the RBS sequence of T7RNAP on the genome in the BL21 (DE3) and BL21 (DE3)-RBS8G strain.

Reference

1. Wang Y, Cheng H, Liu Y, Wen X, Zhang K, Ma Y. In-situ generation of large numbers of genetic combinations for metabolic reprogramming via CRISPR-guided base editing. Nature communications. 2021; 12(1): 1-12.