Difference between revisions of "Part:BBa K3868095"

 
Line 5: Line 5:
 
pCas plasmid of the Crispr-Cas9 system contains Pcas, Spcas9, paraB, λ-red, paraC and arac etc, which plays a role in cutting DNA double strands.
 
pCas plasmid of the Crispr-Cas9 system contains Pcas, Spcas9, paraB, λ-red, paraC and arac etc, which plays a role in cutting DNA double strands.
  
−
<!-- Add more about the biology of this part here
 
−
===Usage and Biology===
 
−
 
−
<!-- -->
 
 
<span class='h3bb'>Sequence and Features</span>
 
<span class='h3bb'>Sequence and Features</span>
 
<partinfo>BBa_K3868095 SequenceAndFeatures</partinfo>
 
<partinfo>BBa_K3868095 SequenceAndFeatures</partinfo>
  
 +
===Usage and Biology===
  
 +
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;To achieve the editing of the RBS sequence using CBE, a tailored RBS sequence of 5'-GGGGGGGG-3' was integrated into the corresponding site of the T7 RNAP, yielding a starting strain of BL21 (DE3)-RBS8G. Here, the CRISPR/Cas9 system was used to construct the BL21 (DE3)-RBS8G strain. The pCas and pTarget plamids was provided by our PI, Xiao-Man Sun. In the genome of BL21 (DE3), the CCGGATTTACTAACTGGAAG was chosen as N20 sequence, and then the pTarget-8G plasmid was successfully constructed based on the pTarget (Fig. 1).
 +
<html>
 +
<div align="center">
 +
    <figure>
 +
        <img src="https://2021.igem.org/wiki/images/9/98/T--NNU-China--contribution-1.png" width="60%" style="float:center">
 +
        <figcaption>
 +
        <p style="font-size:1rem">
 +
        </p>
 +
        </figcaption>
 +
    </figure>
 +
</div>
 +
</html>
 +
<div align="center">
 +
:'''Fig 1. The Schematic diagram of pCas, pTarget, and the composite part of <partinfo>BBa_K3868095 </partinfo> and <partinfo>BBa_K3868096 </partinfo> '''
 +
</div>
 +
===Usage and Biology===
 +
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; By sequencing, the RBS sequence of T7RNAP on the genome was successfully replaced by GGGGGGGG (Fig. 2), which indicated that the starting strain BL21 (DE3)-RBS8G was successfully constructed. 
 +
 +
<html>
 +
<div align="center">
 +
    <figure>
 +
        <img src="https://2021.igem.org/wiki/images/9/98/T--NNU-China--contribution-1.png" width="60%" style="float:center">
 +
        <figcaption>
 +
        <p style="font-size:1rem">
 +
        </p>
 +
        </figcaption>
 +
    </figure>
 +
</div>
 +
</html>
 +
<div align="center">
 +
:'''Fig 2. The sequencing results of the RBS sequence of T7RNAP on the genome in the BL21 (DE3) and BL21 (DE3)-RBS8G strain. '''
 +
</div>
 +
 +
<p><b><h2>Reference</h2></b></p>
 +
<p>1. Wang Y, Cheng H, Liu Y, Wen X, Zhang K, Ma Y. In-situ generation of large numbers of genetic combinations for metabolic reprogramming via CRISPR-guided base editing. Nature communications. 2021; 12(1): 1-12.
 +
 +
<!-- -->
 
<!-- Uncomment this to enable Functional Parameter display  
 
<!-- Uncomment this to enable Functional Parameter display  
 
===Functional Parameters===
 
===Functional Parameters===
 
<partinfo>BBa_K3868095 parameters</partinfo>
 
<partinfo>BBa_K3868095 parameters</partinfo>
 
<!-- -->
 
<!-- -->

Revision as of 08:20, 19 October 2021


pCas

pCas plasmid of the Crispr-Cas9 system contains Pcas, Spcas9, paraB, λ-red, paraC and arac etc, which plays a role in cutting DNA double strands.

Sequence and Features


Assembly Compatibility:
  • 10
    INCOMPATIBLE WITH RFC[10]
    Illegal EcoRI site found at 1572
    Illegal EcoRI site found at 2469
    Illegal EcoRI site found at 3978
    Illegal PstI site found at 3473
    Illegal PstI site found at 3720
  • 12
    INCOMPATIBLE WITH RFC[12]
    Illegal EcoRI site found at 1572
    Illegal EcoRI site found at 2469
    Illegal EcoRI site found at 3978
    Illegal NheI site found at 1331
    Illegal PstI site found at 3473
    Illegal PstI site found at 3720
  • 21
    INCOMPATIBLE WITH RFC[21]
    Illegal EcoRI site found at 1572
    Illegal EcoRI site found at 2469
    Illegal EcoRI site found at 3978
    Illegal BamHI site found at 2408
  • 23
    INCOMPATIBLE WITH RFC[23]
    Illegal EcoRI site found at 1572
    Illegal EcoRI site found at 2469
    Illegal EcoRI site found at 3978
    Illegal PstI site found at 3473
    Illegal PstI site found at 3720
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal EcoRI site found at 1572
    Illegal EcoRI site found at 2469
    Illegal EcoRI site found at 3978
    Illegal PstI site found at 3473
    Illegal PstI site found at 3720
    Illegal AgeI site found at 3900
  • 1000
    COMPATIBLE WITH RFC[1000]

Usage and Biology

        To achieve the editing of the RBS sequence using CBE, a tailored RBS sequence of 5'-GGGGGGGG-3' was integrated into the corresponding site of the T7 RNAP, yielding a starting strain of BL21 (DE3)-RBS8G. Here, the CRISPR/Cas9 system was used to construct the BL21 (DE3)-RBS8G strain. The pCas and pTarget plamids was provided by our PI, Xiao-Man Sun. In the genome of BL21 (DE3), the CCGGATTTACTAACTGGAAG was chosen as N20 sequence, and then the pTarget-8G plasmid was successfully constructed based on the pTarget (Fig. 1).

Fig 1. The Schematic diagram of pCas, pTarget, and the composite part of BBa_K3868095 and BBa_K3868096

Usage and Biology

         By sequencing, the RBS sequence of T7RNAP on the genome was successfully replaced by GGGGGGGG (Fig. 2), which indicated that the starting strain BL21 (DE3)-RBS8G was successfully constructed.

Fig 2. The sequencing results of the RBS sequence of T7RNAP on the genome in the BL21 (DE3) and BL21 (DE3)-RBS8G strain.

Reference

1. Wang Y, Cheng H, Liu Y, Wen X, Zhang K, Ma Y. In-situ generation of large numbers of genetic combinations for metabolic reprogramming via CRISPR-guided base editing. Nature communications. 2021; 12(1): 1-12.