Difference between revisions of "Part:BBa K3916005"

 
Line 4: Line 4:
  
 
PTT5-S1-his-B.1.1.7
 
PTT5-S1-his-B.1.1.7
 +
== Profile ==
 +
=== Name:  PTT5-S1-his-B.1.1.7 ===
 +
=== Base Pairs: 3219 bp ===
 +
=== Origin: A transient protein expression vector for lactating cells ===
 +
=== Properties:  A plasmid used to express protein of S1&RBD ===
 +
== Usage and Biology ==
 +
The S glycoprotein is the immunodominant target for previous NAbs, and comprises an N-terminal domain (NTD), a receptor-binding domain (RBD/S1B), and an S2 subunit. The SARS-CoV RBD [amino acids (aa) 338–506] consists of an S1B core domain (S1BCD) (aa 318–424) and a receptor-binding motif (RBM) (aa 438–498) that directly engages the human receptor hACE2. Meanwhile, The RBD is also a significant neutralization determinant in the inactivated SARS-CoV vaccine because it induces potent NAbs that block SARS-CoV entry.
 +
 +
== Construct design ==
 +
We aimed to construct the plasmid to give the protein (S1&RBD) synthesized from B138 the ability to perform the protein purification and ELISA testing as well as to mimic the property held by the spike protein of the coronavirus.
 +
 +
[[File:T--Shanghai HS--BBa K3916005-Figure1.png|500px|thumb|center|Figure 1. Figure1 Map of pTT5-S1-RBD-his-B117 expression plasmids..]]
 +
The profiles of every basic part are as follows:
 +
===BBa_K3916000===
 +
Name: pTT5
 +
Base Pairs: 4401bp
 +
Origin:  A transient protein expression vector for lactating cells
 +
Properties:  A vector used for protein expression
 +
==== Usage and Biology ====
 +
pTT5(BBa_K3916000) is a mammalian expression vector with 4401bp, which itself has ampicillin resistance. Promoter is CMV,Primers for 5'sequencing: CMV-F:CGCAAATGGGCGGTAGGCGTG; Primers for 3'sequencing: based on sequence design. In this project, we created two plasmids(pTT5-S1 &pTT5-RBD) using the pTT5 backbone to benefit our project as well as any group wishing to conduct coronavirus research. This is important because it provides other researchers intending to study coronaviruses with tools (plasmids) for further research, thus saving steps, materials and time.
 +
[[File:T--Shanghai_HS--BBa_K3916000-Figure2.png|500px|thumb|center|Figure 2. Plasmid Map of pTT5..]]
 +
=== BBa_K3916004 ===
 +
Name: RBD
 +
Base Pairs: 669bp
 +
Origin:  Viral protein binding sites
 +
Properties:  Used for protein expression
 +
==== Usage and Biology ====
 +
BBa_K3916004 is the coding sequence of a kind of protein (RBD). Coronavirus pneumonia (Coronavirus disease 2019, COVID-19) infects the human body with pneumonia caused by the combination of S protein on its surface with angiotensin-converting enzyme 2 (ACE2) receptors. Mutations in the S1 protein in the S protein and its receptor binding domain (RBD) can lead to changes in viral infection capacity and may lead to immune escape. The RBD is also a significant neutralization determinant in the inactivated SARS-CoV vaccine because it induces potent NAbs that block SARS-CoV entry. In this project, we aimed to construct a plasmid to give the protein of RBD synthesized from B138 the ability to perform the protein purification and ELISA testing as well as to mimic the property held by the spike protein of the coronavirus.
 +
===BBa_K3916001===
 +
Name: S1
 +
Base Pairs: 2082bp
 +
Origin: The infecting area of virus
 +
Properties:  Used for protein expression
 +
==== Usage and Biology ====
 +
The coronavirus genome is comprised of ∼30000 nucleotides. It encodes four structural proteins, Nucleocapsid (N) protein, Membrane (M) protein, Spike (S) protein and Envelop (E) protein and several non-structural proteins. COVID-19 is caused by the novel severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2). SARS-CoV-2 infection may be asymptomatic or it may cause a wide spectrum of symptoms, such as mild symptoms of upper respiratory tract infection and life-threatening sepsis.
 +
The S glycoprotein is the immunodominant target for previous NAbs, and comprises an N-terminal domain (NTD), a receptor-binding domain (RBD/S1B), and an S2 subunit. The SARS-CoV RBD [amino acids (aa) 338–506] consists of an S1B core domain (S1BCD) (aa 318–424) and a receptor-binding motif (RBM) (aa 438–498) that directly engages the human receptor hACE2. Meanwhile, The RBD is also a significant neutralization determinant in the inactivated SARS-CoV vaccine because it induces potent NAbs that block SARS-CoV entry.
 +
 +
== Experimental approach ==
 +
We constructed the plasmid (BBa_K3916006) then used the method of PCR to replicate the fragment of RBD-800 bp. Moreover, we did enzyme cutting then homologous recombination. Finally we could extract the plasmid for subsequent experiment.
 +
[[File:T--Shanghai HS--BBa K3916005-Figure3.jpg|500px|thumb|center|Figure 3. DNA electrophoresis gel..]]
 +
Electrophoresis is designed to verify the genetic success of our purpose (RBD). We can find this is successful.
 +
Purification of protein
 +
Remove DH5α receptor cells from -80°C and place on ice to melt. Add 20 μl of recombinant plasmid product to the strain, flick the wall of the tube, place on ice for 30 min, heat excites in a water bath at 42°C for 45 s, and then place on ice for 2 min to cool. Add 1000μl LB medium (without antibiotics), shake at 37°C, 220 rpm, and incubate for 60 min. Centrifuge at 5000 rpm for 5 min at room temperature, discard 900 μl supernatant and mix the remaining medium and cells by blowing. Take 100μl of bacterial solution evenly coated on pre-warmed ampicillin-resistant (Amp+) plates and incubated overnight at 37℃ in an inverted incubator; The next day picks monoclonal colonies in 20μl LB liquid medium and take 2μl for PCR sequencing of the bacterial broth to confirm successful recombination. The remaining 18μl was added to 1ml Amp+ LB and incubated for 6-8 hours at 37℃ in the shaker, 220rpm.
 +
[[File:T--Shanghai HS--BBa K3916001-figure2.jpg|500px|thumb|center|Figure 4. SDS-PAGE Gel..]]
 +
We reconstruct the plasmid then use the method of PCR to replicate both fragment of S1-2000 bp and RBD-800 bp.
 +
== Proof of function ==
 +
The fast-evolving of coronaviruses, such as SARS-CoV-2, makes broad-spectrum coronavirus preventional or therapeutical strategies highly sought after. Our results highlighted again the importance of epitope outside or on the verge of RBD/ACE2 interface and would facilitate future endeavors searching for broad-spectrum anti-coronavirus approaches. Overall, we presented evidence that 3E8 is a promising therapeutic candidate for the coronavirus pandemic and believe that it represents a significant conceptual advance in fighting COVID-19, which keeps evolving and may open the door for more ACE2-targeting drug discovery and development.
 +
1.3E8 Binds Human ACE2 With Moderate Affinity
 +
[[File:T--Shanghai HS--BBa K3916000-Figure3.jpg|500px|thumb|center|Figure 5. Monoclonal antibody 3E8 and recombinant S1-subunits or RBD from different coronaviruses (and SARS-CoV-2 mutant variants) bound to His-tagged recombinant human ACE2 protein: (A) Binding of 3E8 to His-tagged recombinant human ACE2 protein as measured by ELISA; (B) Binding of 3E8 to His-tagged human ACE2 as measured by BLI; (C-G) Bindings of recombinant S1-subunits or RBD (in F only) from multiple coronaviruses and SARS-CoV-2 mutated variants to recombinant human ACE2 protein as measured by ELISA; (H) The EC50 values of recombinant S1-subunit bindings to human ACE2..]]
 +
 +
We measured the binding affinity of 3E8 to His-tagged human ACE2 protein with ELISA and biolayer interferometry (BLI). The EC50 value was 15.3 nM in ELISA (Fig. 5A) and the dissociation constant (KD) was 30.5 nM in BLI (Fig. 5B). It is also bound to HEK293F cells ectopically overexpressing human ACE2 and to Vero E6 cells endogenously expressing human ACE2, as demonstrated by flow cytometry (Fig. S1E).
 +
2. 3E8 Blocks The Bindings Of S1-Subunits Or RBD From Multiple Coronaviruses To ACE2
 +
We investigated the abilities of 3E8 to block the ACE2 binding of S1-subunits or RBD from SARS-CoV-2, SARS-CoV-2-D614G, B.1.1.7, B.1.351, B.1.617, P.1, SARS-CoV and HCoV-NL63. These S1-subunits or RBD can all bind to His-tagged human ACE2 molecules (Fig. 5C-G), and the EC50 values to His-tagged recombinant human ACE2 molecule were 11.8, 2.6, 0.8, 6.9, 51.3, 14.9, 1.1 and 24.2 nM, respectively (Fig. 5H).
 +
[[File:T--Shanghai HS--BBa K3916001-figure3.jpg|500px|thumb|center|Figure 6. 3E8 blocked the bindings of recombinant S1 or RBD from multiple coronaviruses and the mutant variants of SARS-CoV-2 to His-tagged recombinant human ACE2 protein: (A-E) Bindings of recombinant S1 or RBD (in D only) from different coronaviruses and SARS-CoV-2 mutated variants to recombinant human ACE2 protein were blocked by 3E8. (F) The IC50 values of 3E8 in blocking S1 or RBD binding to human ACE2 protein..]]
 +
Incubation with 3E8 effectively blocked all S1-subunits or RBD binding to ACE2 (Fig. 6A-E) and the IC50 values were 7.1, 13.8, 10.0, 3.7, 10.5, 9.3, 13.7 and 5.0 nM, respectively (Fig. 6F). Thus, 3E8 can broadly block the binding of S1-subunits or RBD from multiple coronaviruses, including the fast-spreading SARS-CoV-2 variants, to human ACE2 molecules.
 +
3. 3E8 Abolishes The Infectivity Of Multiple Pseudo-Typed Coronaviruses
 +
[[File:T--Shanghai HS--BBa K3916004-Figure2.jpg|500px|thumb|center|Figure 7. 3E8 blocked the infection of ACE2-expressing cells by multiple pseudo-typed coronavirus constructs. ACE2-Fc and B38 were used as positive controls, and human IgG4 isotype was negative control. (A-G) 3E8 blocked the infection of ACE2-overexpressing HEK293 cells by different pseudo-typed coronavirus constructed with Env-defective HIV-1 and full-length S-proteins from SARS-CoV-2, SARS-CoV-2-D614G, B.1.1.7, B.1.351, B.1.617, SARS-CoV and HCoV-NL63. (H) The IC50 values of 3E8 in blocking pseudo-typed coronaviruses..]]
 +
We next constructed pseudo-typed coronaviruses with full-length S-proteins from SARS-CoV-2, SARS-CoV-2-D614G, B.1.1.7, B.1.351, B.1.617, SARS-CoV and HCoV-NL63 (Fig. 7A-G). All pseudoviruses could infect HEK293F cells that ectopically express human ACE2, while SARS-CoV-2-D614G showed significantly enhanced infectivity when compared to the original SARS-CoV-2 (Fig. S2). Incubation with 3E8 fully abolished the infectivity of all pseudoviruses, with IC50 values at 0.1, 0.1, 0.07, 0.3, 0.08, 0.2 and 1.1 nM, respectively (Fig. 7H).
 +
In comparison, B38, a SARS-CoV-2 RBD-targeting antibody currently under clinical development, could only suppress the infectivity of SARS-CoV-2, SARS-CoV-2-D614G, B.1.1.7 and B.1.617, but not B.1.351, SARS-CoV or HCoV-NL63. The suppression of 3E8 was not only broader but also remarkably more efficacious and potent, as the IC50 values of 3E8 were hundreds of folds improved when compared to that of B38 (Fig. 7H). The ACE2-Fc fusion protein, a virus RBD-targeting molecule consisting of the extracellular domain of human ACE2 and the Fc region of human IgG1, showed broad but mediocre blocking ability on pseudoviruses. Our investigation indicated that 3E8 is potentially a powerful and broad-spectrum blocker on coronaviruses that are dependent on ACE2.
 +
 +
== Improvement of an existing part ==
 +
1. We have successfully optimized the protein expression sequence
 +
Compared to the old part BBa_K3683000(Part:BBa K3683000 - parts.igem.org) we design a new part BBa_K3916005, both can express S1&RBD protein. The sequence of 1485bp between the two genes is duplicate, and the rest is different, proving that we have optimized the existing gene sequence, providing a variety of gene expression ideas that may make a big difference to functions.
 +
[[File:T--Shanghai HS--BBa K3916005-Figure8.jpg|500px|thumb|center|Figure 8. The blast results about the sequence of our new part BBa_K3916005 and the old one BBa_K3683000..]]
 +
2. We screened out antibodies with high inhibition activity, which proved the effectiveness of our expression vectors. Our results highlighted again the importance of epitope outside or on the verge of RBD/ACE2 interface and would facilitate future endeavors searching for broad-spectrum anti-coronavirus approaches. Overall, we presented evidence that 3E8 is a promising therapeutic candidate for the coronavirus pandemic and believe that it represents a significant conceptual advance in fighting COVID-19, which keeps evolving and may open the door for more ACE2-targeting drug discovery and development.
 +
[[File:T--Shanghai HS--BBa K3916001-figure3.jpg|500px|thumb|center|Figure 9. 3E8 blocked the bindings of recombinant S1 or RBD from multiple coronaviruses and the mutant variants of SARS-CoV-2 to His-tagged recombinant human ACE2 protein: (A-E) Bindings of recombinant S1 or RBD (in D only) from different coronaviruses and SARS-CoV-2 mutated variants to recombinant human ACE2 protein were blocked by 3E8. (F) The IC50 values of 3E8 in blocking S1 or RBD binding to human ACE2 protein..]]
 +
 +
We proposed a new antibody, proteins that can target and block the ACE2 receptor. We got the antibody 3E8 which was screened out from plenty of antibodies and was able to target and the ACE2 receptor. Consequently, mutation type as the virus is, the antibody 3E8 will effectively block the virus entry due to the close of the “door”.
 +
 +
== References ==
 +
 +
1.Assistant Secretary for Public Affairs (ASPA). (2021, June 28). Monoclonal Antibodies for High-Risk COVID-19 Positive Patients. combatCOVID.hhs.gov.
 +
2.
 +
Boopathi, S., Poma, A. B., & Kolandaivel, P. (2021, June). Novel 2019 coronavirus structure, mechanism of action, antiviral drug promises and rule out against its treatment. Journal of biomolecular structure & dynamics.
 +
3.
 +
Centers for Disease Control and Prevention. (n.d.). Test for Current Infection. Centers for Disease Control and Prevention.
 +
4.
 +
Huang, Y., Sun, H., Yu, H., Li, S., Zheng, Q., & Xia, N. (2020, December 28). Neutralizing antibodies against SARS-CoV-2: current understanding, challenge and perspective. Antibody therapeutics.
 +
 +
  
<!-- Add more about the biology of this part here
 
===Usage and Biology===
 
  
 
<!-- -->
 
<!-- -->

Revision as of 06:50, 19 October 2021


PTT5-S1-his-B.1.1.7

PTT5-S1-his-B.1.1.7

Profile

Name: PTT5-S1-his-B.1.1.7

Base Pairs: 3219 bp

Origin: A transient protein expression vector for lactating cells

Properties: A plasmid used to express protein of S1&RBD

Usage and Biology

The S glycoprotein is the immunodominant target for previous NAbs, and comprises an N-terminal domain (NTD), a receptor-binding domain (RBD/S1B), and an S2 subunit. The SARS-CoV RBD [amino acids (aa) 338–506] consists of an S1B core domain (S1BCD) (aa 318–424) and a receptor-binding motif (RBM) (aa 438–498) that directly engages the human receptor hACE2. Meanwhile, The RBD is also a significant neutralization determinant in the inactivated SARS-CoV vaccine because it induces potent NAbs that block SARS-CoV entry.

Construct design

We aimed to construct the plasmid to give the protein (S1&RBD) synthesized from B138 the ability to perform the protein purification and ELISA testing as well as to mimic the property held by the spike protein of the coronavirus.

Figure 1. Figure1 Map of pTT5-S1-RBD-his-B117 expression plasmids..

The profiles of every basic part are as follows:

BBa_K3916000

Name: pTT5 Base Pairs: 4401bp Origin: A transient protein expression vector for lactating cells Properties: A vector used for protein expression

Usage and Biology

pTT5(BBa_K3916000) is a mammalian expression vector with 4401bp, which itself has ampicillin resistance. Promoter is CMV,Primers for 5'sequencing: CMV-F:CGCAAATGGGCGGTAGGCGTG; Primers for 3'sequencing: based on sequence design. In this project, we created two plasmids(pTT5-S1 &pTT5-RBD) using the pTT5 backbone to benefit our project as well as any group wishing to conduct coronavirus research. This is important because it provides other researchers intending to study coronaviruses with tools (plasmids) for further research, thus saving steps, materials and time.

Figure 2. Plasmid Map of pTT5..

BBa_K3916004

Name: RBD Base Pairs: 669bp Origin: Viral protein binding sites Properties: Used for protein expression

Usage and Biology

BBa_K3916004 is the coding sequence of a kind of protein (RBD). Coronavirus pneumonia (Coronavirus disease 2019, COVID-19) infects the human body with pneumonia caused by the combination of S protein on its surface with angiotensin-converting enzyme 2 (ACE2) receptors. Mutations in the S1 protein in the S protein and its receptor binding domain (RBD) can lead to changes in viral infection capacity and may lead to immune escape. The RBD is also a significant neutralization determinant in the inactivated SARS-CoV vaccine because it induces potent NAbs that block SARS-CoV entry. In this project, we aimed to construct a plasmid to give the protein of RBD synthesized from B138 the ability to perform the protein purification and ELISA testing as well as to mimic the property held by the spike protein of the coronavirus.

BBa_K3916001

Name: S1 Base Pairs: 2082bp Origin: The infecting area of virus Properties: Used for protein expression

Usage and Biology

The coronavirus genome is comprised of ∼30000 nucleotides. It encodes four structural proteins, Nucleocapsid (N) protein, Membrane (M) protein, Spike (S) protein and Envelop (E) protein and several non-structural proteins. COVID-19 is caused by the novel severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2). SARS-CoV-2 infection may be asymptomatic or it may cause a wide spectrum of symptoms, such as mild symptoms of upper respiratory tract infection and life-threatening sepsis. The S glycoprotein is the immunodominant target for previous NAbs, and comprises an N-terminal domain (NTD), a receptor-binding domain (RBD/S1B), and an S2 subunit. The SARS-CoV RBD [amino acids (aa) 338–506] consists of an S1B core domain (S1BCD) (aa 318–424) and a receptor-binding motif (RBM) (aa 438–498) that directly engages the human receptor hACE2. Meanwhile, The RBD is also a significant neutralization determinant in the inactivated SARS-CoV vaccine because it induces potent NAbs that block SARS-CoV entry.

Experimental approach

We constructed the plasmid (BBa_K3916006) then used the method of PCR to replicate the fragment of RBD-800 bp. Moreover, we did enzyme cutting then homologous recombination. Finally we could extract the plasmid for subsequent experiment.

Figure 3. DNA electrophoresis gel..

Electrophoresis is designed to verify the genetic success of our purpose (RBD). We can find this is successful. Purification of protein Remove DH5α receptor cells from -80°C and place on ice to melt. Add 20 μl of recombinant plasmid product to the strain, flick the wall of the tube, place on ice for 30 min, heat excites in a water bath at 42°C for 45 s, and then place on ice for 2 min to cool. Add 1000μl LB medium (without antibiotics), shake at 37°C, 220 rpm, and incubate for 60 min. Centrifuge at 5000 rpm for 5 min at room temperature, discard 900 μl supernatant and mix the remaining medium and cells by blowing. Take 100μl of bacterial solution evenly coated on pre-warmed ampicillin-resistant (Amp+) plates and incubated overnight at 37℃ in an inverted incubator; The next day picks monoclonal colonies in 20μl LB liquid medium and take 2μl for PCR sequencing of the bacterial broth to confirm successful recombination. The remaining 18μl was added to 1ml Amp+ LB and incubated for 6-8 hours at 37℃ in the shaker, 220rpm.

Figure 4. SDS-PAGE Gel..

We reconstruct the plasmid then use the method of PCR to replicate both fragment of S1-2000 bp and RBD-800 bp.

Proof of function

The fast-evolving of coronaviruses, such as SARS-CoV-2, makes broad-spectrum coronavirus preventional or therapeutical strategies highly sought after. Our results highlighted again the importance of epitope outside or on the verge of RBD/ACE2 interface and would facilitate future endeavors searching for broad-spectrum anti-coronavirus approaches. Overall, we presented evidence that 3E8 is a promising therapeutic candidate for the coronavirus pandemic and believe that it represents a significant conceptual advance in fighting COVID-19, which keeps evolving and may open the door for more ACE2-targeting drug discovery and development. 1.3E8 Binds Human ACE2 With Moderate Affinity

Figure 5. Monoclonal antibody 3E8 and recombinant S1-subunits or RBD from different coronaviruses (and SARS-CoV-2 mutant variants) bound to His-tagged recombinant human ACE2 protein: (A) Binding of 3E8 to His-tagged recombinant human ACE2 protein as measured by ELISA; (B) Binding of 3E8 to His-tagged human ACE2 as measured by BLI; (C-G) Bindings of recombinant S1-subunits or RBD (in F only) from multiple coronaviruses and SARS-CoV-2 mutated variants to recombinant human ACE2 protein as measured by ELISA; (H) The EC50 values of recombinant S1-subunit bindings to human ACE2..

We measured the binding affinity of 3E8 to His-tagged human ACE2 protein with ELISA and biolayer interferometry (BLI). The EC50 value was 15.3 nM in ELISA (Fig. 5A) and the dissociation constant (KD) was 30.5 nM in BLI (Fig. 5B). It is also bound to HEK293F cells ectopically overexpressing human ACE2 and to Vero E6 cells endogenously expressing human ACE2, as demonstrated by flow cytometry (Fig. S1E). 2. 3E8 Blocks The Bindings Of S1-Subunits Or RBD From Multiple Coronaviruses To ACE2 We investigated the abilities of 3E8 to block the ACE2 binding of S1-subunits or RBD from SARS-CoV-2, SARS-CoV-2-D614G, B.1.1.7, B.1.351, B.1.617, P.1, SARS-CoV and HCoV-NL63. These S1-subunits or RBD can all bind to His-tagged human ACE2 molecules (Fig. 5C-G), and the EC50 values to His-tagged recombinant human ACE2 molecule were 11.8, 2.6, 0.8, 6.9, 51.3, 14.9, 1.1 and 24.2 nM, respectively (Fig. 5H).

Figure 6. 3E8 blocked the bindings of recombinant S1 or RBD from multiple coronaviruses and the mutant variants of SARS-CoV-2 to His-tagged recombinant human ACE2 protein: (A-E) Bindings of recombinant S1 or RBD (in D only) from different coronaviruses and SARS-CoV-2 mutated variants to recombinant human ACE2 protein were blocked by 3E8. (F) The IC50 values of 3E8 in blocking S1 or RBD binding to human ACE2 protein..

Incubation with 3E8 effectively blocked all S1-subunits or RBD binding to ACE2 (Fig. 6A-E) and the IC50 values were 7.1, 13.8, 10.0, 3.7, 10.5, 9.3, 13.7 and 5.0 nM, respectively (Fig. 6F). Thus, 3E8 can broadly block the binding of S1-subunits or RBD from multiple coronaviruses, including the fast-spreading SARS-CoV-2 variants, to human ACE2 molecules. 3. 3E8 Abolishes The Infectivity Of Multiple Pseudo-Typed Coronaviruses

Figure 7. 3E8 blocked the infection of ACE2-expressing cells by multiple pseudo-typed coronavirus constructs. ACE2-Fc and B38 were used as positive controls, and human IgG4 isotype was negative control. (A-G) 3E8 blocked the infection of ACE2-overexpressing HEK293 cells by different pseudo-typed coronavirus constructed with Env-defective HIV-1 and full-length S-proteins from SARS-CoV-2, SARS-CoV-2-D614G, B.1.1.7, B.1.351, B.1.617, SARS-CoV and HCoV-NL63. (H) The IC50 values of 3E8 in blocking pseudo-typed coronaviruses..

We next constructed pseudo-typed coronaviruses with full-length S-proteins from SARS-CoV-2, SARS-CoV-2-D614G, B.1.1.7, B.1.351, B.1.617, SARS-CoV and HCoV-NL63 (Fig. 7A-G). All pseudoviruses could infect HEK293F cells that ectopically express human ACE2, while SARS-CoV-2-D614G showed significantly enhanced infectivity when compared to the original SARS-CoV-2 (Fig. S2). Incubation with 3E8 fully abolished the infectivity of all pseudoviruses, with IC50 values at 0.1, 0.1, 0.07, 0.3, 0.08, 0.2 and 1.1 nM, respectively (Fig. 7H). In comparison, B38, a SARS-CoV-2 RBD-targeting antibody currently under clinical development, could only suppress the infectivity of SARS-CoV-2, SARS-CoV-2-D614G, B.1.1.7 and B.1.617, but not B.1.351, SARS-CoV or HCoV-NL63. The suppression of 3E8 was not only broader but also remarkably more efficacious and potent, as the IC50 values of 3E8 were hundreds of folds improved when compared to that of B38 (Fig. 7H). The ACE2-Fc fusion protein, a virus RBD-targeting molecule consisting of the extracellular domain of human ACE2 and the Fc region of human IgG1, showed broad but mediocre blocking ability on pseudoviruses. Our investigation indicated that 3E8 is potentially a powerful and broad-spectrum blocker on coronaviruses that are dependent on ACE2.

Improvement of an existing part

1. We have successfully optimized the protein expression sequence Compared to the old part BBa_K3683000(Part:BBa K3683000 - parts.igem.org) we design a new part BBa_K3916005, both can express S1&RBD protein. The sequence of 1485bp between the two genes is duplicate, and the rest is different, proving that we have optimized the existing gene sequence, providing a variety of gene expression ideas that may make a big difference to functions.

Figure 8. The blast results about the sequence of our new part BBa_K3916005 and the old one BBa_K3683000..

2. We screened out antibodies with high inhibition activity, which proved the effectiveness of our expression vectors. Our results highlighted again the importance of epitope outside or on the verge of RBD/ACE2 interface and would facilitate future endeavors searching for broad-spectrum anti-coronavirus approaches. Overall, we presented evidence that 3E8 is a promising therapeutic candidate for the coronavirus pandemic and believe that it represents a significant conceptual advance in fighting COVID-19, which keeps evolving and may open the door for more ACE2-targeting drug discovery and development.

Figure 9. 3E8 blocked the bindings of recombinant S1 or RBD from multiple coronaviruses and the mutant variants of SARS-CoV-2 to His-tagged recombinant human ACE2 protein: (A-E) Bindings of recombinant S1 or RBD (in D only) from different coronaviruses and SARS-CoV-2 mutated variants to recombinant human ACE2 protein were blocked by 3E8. (F) The IC50 values of 3E8 in blocking S1 or RBD binding to human ACE2 protein..

We proposed a new antibody, proteins that can target and block the ACE2 receptor. We got the antibody 3E8 which was screened out from plenty of antibodies and was able to target and the ACE2 receptor. Consequently, mutation type as the virus is, the antibody 3E8 will effectively block the virus entry due to the close of the “door”.

References

1.Assistant Secretary for Public Affairs (ASPA). (2021, June 28). Monoclonal Antibodies for High-Risk COVID-19 Positive Patients. combatCOVID.hhs.gov. 2. Boopathi, S., Poma, A. B., & Kolandaivel, P. (2021, June). Novel 2019 coronavirus structure, mechanism of action, antiviral drug promises and rule out against its treatment. Journal of biomolecular structure & dynamics. 3. Centers for Disease Control and Prevention. (n.d.). Test for Current Infection. Centers for Disease Control and Prevention. 4. Huang, Y., Sun, H., Yu, H., Li, S., Zheng, Q., & Xia, N. (2020, December 28). Neutralizing antibodies against SARS-CoV-2: current understanding, challenge and perspective. Antibody therapeutics.



Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    INCOMPATIBLE WITH RFC[21]
    Illegal BglII site found at 125
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Illegal BsaI.rc site found at 2038
    Illegal SapI.rc site found at 1434
    Illegal SapI.rc site found at 2517
    Illegal SapI.rc site found at 2730