Difference between revisions of "Part:BBa K3859007"

 
(9 intermediate revisions by the same user not shown)
Line 3: Line 3:
 
<partinfo>BBa_K3859007 short</partinfo>
 
<partinfo>BBa_K3859007 short</partinfo>
  
BBa_K3859007 is crRNA we designed for CRISPR Cas12a detection. crRNA is a guied RNA for cas12a enzyme to find the target sequence and combine to it. It made of two components one is repeat sequence and another one is target sequence[1]. The crRNA repeat, which is<b>  "UAAUUUCUACUAAGUGUAGAU" </b>and will be the same for all EnGen Lba Cas12a guides. The repeat is followed by a target specific sequence, which will vary depending on the target. The target sequence of this crRNA(BBa_K3859007) is barcode GBSZ ARTAG(BBa_K3859000). We transfer the BBa_K3859000 which is a segment of DNA sequence into RNA sequence and add to the repeat sequence(fig.8A).  
+
BBa_K3859007 is crRNA we designed for CRISPR Cas12a detection. crRNA is a guied RNA for cas12a enzyme to find the target sequence and combine to it. It made of two components one is repeat sequence and another one is target sequence[1]. The crRNA repeat, which is<b>  "UAAUUUCUACUAAGUGUAGAU" </b>and will be the same for all EnGen Lba Cas12a guides. The repeat is followed by a target specific sequence, which will vary depending on the target. The target sequence of this crRNA(BBa_K3859007) is barcode GBSZ ARTAG(BBa_K3859000). We transfer the BBa_K3859000 which is a segment of DNA sequence into RNA sequence and add to the repeat sequence(fig.1).  
  
 
<div style='text-align: center;'>
 
<div style='text-align: center;'>
[[File:T--GreatBay_SZ--crRNA_for_each_barcode.png|600px|thumb|center]]
+
[[File:T--GreatBay SZ--table of crRNA.png|600px|thumb|center]]
  
<b> 【fig.8A】Corresponding crRNA sequence for each barcodes  </b>
+
<b> 【fig.1】Corresponding crRNA sequence for each barcodes  </b>
  
 
</div>
 
</div>
  
  
<b><font size="+1.2"> Experienment and result </font></b>
+
<b><font size="+1.2"> Characterization </font></b>
  
The crRNA is designed to be complementary to the target DNA sequence. So when the cas12a-crRNA complex is added to the system, the crRNA will recognize the target DNA sequence and bind with it, forming a ternary complex. Then the cas12a protein will start to cut the single strand DNAs (ssDNA)-it will cut not only on the target sequence, but also any single strand DNA that presents in the system. As a result, the ssDNA probe added into the reaction system will be cut by the cas12a protein. Depending the type of ssDNA probe added into the system, the probe will either produce florescence or show a red line on the test stripe(fig.8B)[2].  
+
The crRNA is designed to be complementary to the target DNA sequence. So when the cas12a-crRNA complex is added to the system, the crRNA will recognize the target DNA sequence and bind with it, forming a ternary complex. Then the cas12a protein will start to cut the single strand DNAs (ssDNA)-it will cut not only on the target sequence, but also any single strand DNA that presents in the system. As a result, the ssDNA probe added into the reaction system will be cut by the cas12a protein. Depending the type of ssDNA probe added into the system, the probe will either produce florescence or show a red line on the test stripe(fig.2)[2].  
  
 
<div style='text-align: center;'>
 
<div style='text-align: center;'>
[[File:File:T--GreatBay_SZ--cas12a_detection.png|600px|thumb|center]]
+
[[File:T--GreatBay SZ--cas12a detection.png|600px|thumb|center]]
  
<b> 【fig.8B】Cas12a detection </b>
+
<b> 【fig.2】Cas12a detection </b>
  
 
</div>
 
</div>
  
 +
<b><font size="+1.2"> Experienment and result </font></b>
  
We used both the test strip and the florencence method. For the test strip, we successfully got the correct result for all the barcodes(fig.8C). For the florencence method, we got the graphs of the florencence against time(fig.8D)[2], which were proofed right by our model.  
+
We used both the test strip and the florencence method. For the test strip, we successfully got the correct result for all the barcodes(fig.3). For the florencence method, we got the graphs of the florencence against time(fig.4)[2], which were proofed right by our model.  
  
 
<div style='text-align: center;'>
 
<div style='text-align: center;'>
[[File:File:T--GreatBay_SZ--cas12a_test_strip.png|600px|thumb|center]]
+
[[File:T--GreatBay SZ--cas12a test strip.png|600px|thumb|center]]
  
<b> 【fig.8C】Cas12a test strip result </b>
+
<b> 【fig.3】Cas12a test strip result </b>
  
[[File:File:T--GreatBay_SZ--fluorescence_detection.png|600px|thumb|center]]
+
[[File:T--GreatBay SZ--fluorescence detection.png|600px|thumb|center]]
  
<b> 【fig.8D】cas12a fluorescence detection result. On the left of the symbol "-" refers to barcode name; On the right of the symbol "-" refers to crRNA name. All results for barcode mismatch with crRNA are shown in grey. E.g. "T-T" means the mixture of T-barcode and T-crRNA.  </b>
+
<b> 【fig.4】Cas12a fluorescence detection result. On the left of the symbol "-" refers to barcode name; On the right of the symbol "-" refers to crRNA name. All results for barcode mismatch with crRNA are shown in grey. E.g. "T-T" means the mixture of T-barcode and T-crRNA.  </b>
  
 
</div>
 
</div>
  
In addition, in order to test the specificity of our barcode design.  We constructed 7 barcodes and their matching CRISPR RNAs (crRNAs) and assayed all permutations in vitro using cas12a florencence detection(fig.8E)[2].
+
In addition, in order to test the specificity of our barcode design.  We constructed 7 barcodes and their matching CRISPR RNAs (crRNAs) and assayed all permutations in vitro using cas12a florencence detection(fig.5)[2].
  
<div style='text-align: center;'>
 
[[File:File:T--GreatBay_SZ--cas12a_orthogonal_experiment_heat_map.png|600px|thumb|center]]
 
  
<b> 【fig.8E】Heatmap of endpoint fluorescence values from in cas12a fluorescence detection of all combinations of 7 barcodes and 7 crRNAs assessing specificity of each barcode-crRNA pair.</b>
+
<div style='text-align: center;'>
 +
[[File:T--GreatBay_SZ--cas12a_orthogonal_experiment_heat_map.png|400px|thumb|center]]
  
 +
<b> 【fig.5】Heatmap of endpoint fluorescence values from in cas12a fluorescence detection of all combinations of 7 barcodes and 7 crRNAs assessing specificity of each barcode-crRNA pair.  </b>
 
</div>
 
</div>
  
<b><font size="+1.2"> Reference </font></b>
+
<b><font size="+1.2"> References </font></b>
  
 
1. Li, S. Y., Cheng, Q. X., Liu, J. K., Nie, X. Q., Zhao, G. P., & Wang, J. (2018). CRISPR-Cas12a has both cis- and trans-cleavage activities on single-stranded DNA. Cell research, 28(4), 491–493. https://doi.org/10.1038/s41422-018-0022-x
 
1. Li, S. Y., Cheng, Q. X., Liu, J. K., Nie, X. Q., Zhao, G. P., & Wang, J. (2018). CRISPR-Cas12a has both cis- and trans-cleavage activities on single-stranded DNA. Cell research, 28(4), 491–493. https://doi.org/10.1038/s41422-018-0022-x
  
 
2. Qian, J., Lu, Z. X., Mancuso, C. P., Jhuang, H. Y., Del Carmen Barajas-Ornelas, R., Boswell, S. A., Ramírez-Guadiana, F. H., Jones, V., Sonti, A., Sedlack, K., Artzi, L., Jung, G., Arammash, M., Pettit, M. E., Melfi, M., Lyon, L., Owen, S. V., Baym, M., Khalil, A. S., Silver, P. A., … Springer, M. (2020). Barcoded microbial system for high-resolution object provenance. Science (New York, N.Y.), 368(6495), 1135–1140. https://doi.org/10.1126/science.aba5584
 
2. Qian, J., Lu, Z. X., Mancuso, C. P., Jhuang, H. Y., Del Carmen Barajas-Ornelas, R., Boswell, S. A., Ramírez-Guadiana, F. H., Jones, V., Sonti, A., Sedlack, K., Artzi, L., Jung, G., Arammash, M., Pettit, M. E., Melfi, M., Lyon, L., Owen, S. V., Baym, M., Khalil, A. S., Silver, P. A., … Springer, M. (2020). Barcoded microbial system for high-resolution object provenance. Science (New York, N.Y.), 368(6495), 1135–1140. https://doi.org/10.1126/science.aba5584
 +
  
 
<!-- Add more about the biology of this part here
 
<!-- Add more about the biology of this part here

Latest revision as of 05:08, 19 October 2021


crRNA for GBSZ ARTAG barcode

BBa_K3859007 is crRNA we designed for CRISPR Cas12a detection. crRNA is a guied RNA for cas12a enzyme to find the target sequence and combine to it. It made of two components one is repeat sequence and another one is target sequence[1]. The crRNA repeat, which is "UAAUUUCUACUAAGUGUAGAU" and will be the same for all EnGen Lba Cas12a guides. The repeat is followed by a target specific sequence, which will vary depending on the target. The target sequence of this crRNA(BBa_K3859007) is barcode GBSZ ARTAG(BBa_K3859000). We transfer the BBa_K3859000 which is a segment of DNA sequence into RNA sequence and add to the repeat sequence(fig.1).

T--GreatBay SZ--table of crRNA.png

【fig.1】Corresponding crRNA sequence for each barcodes


Characterization

The crRNA is designed to be complementary to the target DNA sequence. So when the cas12a-crRNA complex is added to the system, the crRNA will recognize the target DNA sequence and bind with it, forming a ternary complex. Then the cas12a protein will start to cut the single strand DNAs (ssDNA)-it will cut not only on the target sequence, but also any single strand DNA that presents in the system. As a result, the ssDNA probe added into the reaction system will be cut by the cas12a protein. Depending the type of ssDNA probe added into the system, the probe will either produce florescence or show a red line on the test stripe(fig.2)[2].

T--GreatBay SZ--cas12a detection.png

【fig.2】Cas12a detection

Experienment and result

We used both the test strip and the florencence method. For the test strip, we successfully got the correct result for all the barcodes(fig.3). For the florencence method, we got the graphs of the florencence against time(fig.4)[2], which were proofed right by our model.

T--GreatBay SZ--cas12a test strip.png

【fig.3】Cas12a test strip result

T--GreatBay SZ--fluorescence detection.png

【fig.4】Cas12a fluorescence detection result. On the left of the symbol "-" refers to barcode name; On the right of the symbol "-" refers to crRNA name. All results for barcode mismatch with crRNA are shown in grey. E.g. "T-T" means the mixture of T-barcode and T-crRNA.

In addition, in order to test the specificity of our barcode design. We constructed 7 barcodes and their matching CRISPR RNAs (crRNAs) and assayed all permutations in vitro using cas12a florencence detection(fig.5)[2].


T--GreatBay SZ--cas12a orthogonal experiment heat map.png

【fig.5】Heatmap of endpoint fluorescence values from in cas12a fluorescence detection of all combinations of 7 barcodes and 7 crRNAs assessing specificity of each barcode-crRNA pair.

References

1. Li, S. Y., Cheng, Q. X., Liu, J. K., Nie, X. Q., Zhao, G. P., & Wang, J. (2018). CRISPR-Cas12a has both cis- and trans-cleavage activities on single-stranded DNA. Cell research, 28(4), 491–493. https://doi.org/10.1038/s41422-018-0022-x

2. Qian, J., Lu, Z. X., Mancuso, C. P., Jhuang, H. Y., Del Carmen Barajas-Ornelas, R., Boswell, S. A., Ramírez-Guadiana, F. H., Jones, V., Sonti, A., Sedlack, K., Artzi, L., Jung, G., Arammash, M., Pettit, M. E., Melfi, M., Lyon, L., Owen, S. V., Baym, M., Khalil, A. S., Silver, P. A., … Springer, M. (2020). Barcoded microbial system for high-resolution object provenance. Science (New York, N.Y.), 368(6495), 1135–1140. https://doi.org/10.1126/science.aba5584


Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]