Latest revision as of 03:46, 19 October 2021

Hypermethylated region of TFPI2

The sequence of Hypermethylated region of TFPI2.We use this part for detection of colorectal cancer (CRC).

Sequence and Features

Usage and Biology

In our project, the trigger sequence is linked to this part by DNA amplification and was added into the cell free system together with the plasmid contain toehold sequence, the report fluorescent protein will be expressed. The visible color and fluorescent signal can indicate the methylation degree of the TFPI2 gene in CRC patients.

Results

1. PCR verification

1.1 primer design

We plan to use the In Vitro protein expression system to detect the methylation degree of the TFPI2 gene in colorectal cancer patients. According to the literature, we designed methylation-specific primers forTFPI2. In order to express in vitro, T7 promoter and trigger sequence were added to the 5 'end of TFPI methylation forward and reverse primers, respectively. For normalization，we also designed unmethylated primers for the internal reference gene ACTB. Same as TFPI2, T7 promoter sequence was added to its forward primer, trigger primer sequence was added to its reverse primer, and a new primer was synthesized respectively.

TFPI2-M: methylation specific primer

T7-TFPI2-F：TAATACGACTCACTATAGGGCGCGGAGATTTTTTGT

Trigger-TFPI2-R：TATGTAATTGATTTGGCTTCTGTTAGTTTCATATTTAACAAACATCGTCGCAAACCTC

ACTB-NM: unmethylated primer

T7-ACTB-F：TAATACGACTCACTATAGGGGGCACCCAGCACAATGAAG

Trigger-ACTB-R：TATGTAATTGATTTGGCTTCTGTTAGTTTCATACTCGTCATACTCCTGCTTGCTG

1.2 PCR verification

Using human species genome DNA and simulated colorectal cancer genome DNA as templates, PCR amplification were carried out on PCR instrument with the same number of gene amplification cycles, and then verified by agarose gel electrophoresis. From the figure below, we can see that ACTB as an internal control has the same expression in both negative and positive samples, while TFPI2, as a biomarker of colorectal cancer, has a weak band (almost invisible) in negative sample and a significant band in positive sample. Which means that the TFPI2 methylation degree has a significant differences between negative and positive samples. This confirms our conjecture that TFPI2 can be used as a biomarker for colorectal cancer detection, and there are significant differences in negative and positive samples.

Figure1.2: TFPI2 colorectal cancer detection (PCR verification). A: PCR products were detected by agarose gel electrophoresis; Marker：50bp DNA Ladder，Line 1: negative colorectal cancer specimen with ACTB non-methylation specific primers，Line 2: negative colorectal cancer samples with TFPI2 methylation specific primers，Line 3: positive colorectal cancer samples with ACTB non-methylation specific primers，Line 4: positive colorectal cancer samples with TFPI2 methylation specific primers B: qPCR experimental results analysis.

1.3 Conclusion:

The results were as anticipated: for methylation detection of TFPI2, band was almost invisible in negative colorectal cancer samples, and obvious bands were found in positive samples. The result shows that our parts can work as expected.

2. In vitro experiment verification

2.1 Cell-free protein expression

We used the cell-free protein expression system to detect the methylation degree of TFPI2 gene in patients with colorectal cancer. As mentioned in the result, we designed the methylated primers of TFPI2 and the non-methylated primers of ACTB as internal controls. The T7 promoter sequence was added to the forward primer, the trigger primer sequence was added to the reverse primer, a new primer was then synthesized respectively. Using normal human genome and simulated colorectal cancer patient genome as templates, we performed PCR amplification with the same number of gene amplification cycles, and then we transfer the PCR amplified product and the Toehold switch plasmid we designed to the cell-free protein expression system and incubated them at 37°C for 3-4 hours for observation. The results show methyl The PCR product amplified by TFPI2 can emit obvious red fluorescence.

Figure2.1：Functional verification of in vitro protein expression system. tube1：Water; tube2:Toehold plasmid only; tube3: Negative colorectal cancer samples with ACTB non-methylation PCR product; tube4: Negative colorectal cancer samples with TFPI2 methylation specific PCR product; tube5: Positive colorectal cancer samples with ACTB non-methylation specific PCR product; tube 6: Positive colorectal cancer samples with TFPI2 methylation specific PCR product.

The system control group1&2 without PCR products showed no sign of red fluorescence; the internal control group 3 and group 5 with ACTB non-methylation PCR product showed similar brilliant fluorescence, indicating that the two samples have the same sample size; the negative sample containing TFPI2 methylation specific PCR product and toehold plasmids showed no sign of red fluorescence, while the positive sample showed brilliant fluorescence. The result shows that our system works as expected.

Fluorescence signal was detected and the following data was obtained. ACTB can be used as both quality control and internal reference to normalize the fluorescence value. Through the analysis of the fluorescence value, we can also make further quantitative analyses to improve the accuracy and sensitivity of the product.

2.2 Dry Lab experiments

Considering that more gradient experiments require more time and samples, as well as a lot of money, we decided to use the modeling method to explore the relationship between the fluorescence signal and the degree of methylation. Through the modeling, we get the following results. Please refer to the detailed modeling process. Our Model page.

The dry lab attempted comparison between direct mcherry expression and that using toehold switch. The result is shown in figure 2.2.1, where certain extent of suppression of expression can be observed upon addition of toehold.

Figure 2.2.1 Expression level comparison.

Additionally, mcherry concentrations over a specific timespan under different methylation degree are also plotted as shown in figure 2.2.2.The predicted mcherry concentration gradient shows a non-linear and non-crossing pattern, indicating successful differentiation between different methylation degrees.