Difference between revisions of "Part:BBa K3875014"

 
 
(One intermediate revision by the same user not shown)
Line 1: Line 1:
  
 
__NOTOC__
 
__NOTOC__
−
<partinfo>BBa_K3875014 short</partinfo>
 
  
−
more information will be provided later.
 
−
 
−
<!-- Add more about the biology of this part here
 
 
===Usage and Biology===
 
===Usage and Biology===
 +
<html>
 +
 +
<strong>Background:</strong>
 +
To improve the part <a href = "https://parts.igem.org/Part:BBa_K1378001" > BBa_K1378001</a>, we mutated the gene <i>gadB</i> of 2019_SCUT
 +
(<a href = "https://parts.igem.org/Part:BBa_K1378001" > BBa_K1378001</a>)
 +
 +
and tried to characterize GadB and GadB(mut) in different pH value. Then results of the two parts are compared.
 +
We first construct the plasmid T7 promoter-gadB(mut) below.<br>
 +
 +
<img src="https://static.igem.org/mediawiki/parts/5/55/T--BUCT--Figure%2C_plasmid_profile_of_pET30-gadB%28mut%29.png"width="640px";height="30px"/><br>
 +
 +
<strong>Design:</strong>
 +
Because we had successfully constructed the composite part (<strong>Lac-gadB(mut)-lac-gdhA-T1</strong>/
 +
<a href = "https://parts.igem.org/Part:BBa_K3875007" > BBa_K3875007</a>),
 +
 +
so we can directly remove the gene <i>gadB(mut)</i> from <strong>Lac-gadB(mut)-lac-gdhA-T1</strong>
 +
(<a href = "https://parts.igem.org/Part:BBa_K3875007" > BBa_K3875007</a>)
 +
 +
with Primer 1  (CTTGAGACCTCCTTCTTAAAGTTAAAC) and Primer 3 (CAAGGGGTTATGCTAGTTATTGCTCTTAGTGATCGCTGAGATATTTCAGG). <br>
 +
 +
After PCR amplification, <strong>pET30-gadB(mut)</strong> and a had the same cohesive end by restriction endonuclease, and then they were connected by T7 ligase. Finally, the linked plasmid was transformed into <i>E. coli</i> DH5a. <br>
 +
 +
After the Polymerase Chain Reaction, the gene run a gel. <br>
 +
 +
<img src="https://static.igem.org/mediawiki/parts/3/38/T--BUCT%E2%80%94gel_1.png"width="640px";height="30px"/><br>
 +
 +
As we can see from this picture, number 9,13,15 is the proper <i>gadB(mut)</i> that we need.<br>
 +
 +
<img src="https://static.igem.org/mediawiki/parts/0/07/T--BUCT%E2%80%94gel_2.png"width="640px";height="30px"/><br>
 +
 +
In order to detect the expression of recombinant gene, the plasmid containing <strong>pET30-gadB(mut)</strong> was transformed into <i>E. coli</i> DH5a for fermentation (In fact, we didn't do it because of time constraints).<br>
 +
 +
After that, we plan to purify the protein GadB (mut) and detect the protein activity of GadB in different pH value.<br>
 +
 +
Our assumption is that our GadB (mut) would remain active at different pH, instead of just being active in pH 4.5.<br>
 +
<br>
 +
<br>
 +
<br>
 +
<br>
 +
 +
<strong>Reference</strong>:
 +
[1] Gut, H., Pennacchietti, E., John, R. A., Bossa, F., Capitani, G., De Biase, D., & Grütter, M. G. (2006). Escherichia coli acid resistance: pH-sensing, activation by chloride and autoinhibition in GadB. The EMBO journal, 25(11), 2643–2651. https://doi.org/10.1038/sj.emboj.7601107<br>
 +
 +
[2] Chae, T. U., Ko, Y. S., Hwang, K. S., & Lee, S. Y. (2017). Metabolic engineering of Escherichia coli for the production of four-, five- and six-carbon lactams. Metabolic engineering, 41, 82–91. https://doi.org/10.1016/j.ymben.2017.04.001<br>
 +
 +
[3] SHUKUYA, R., & SCHWERT, G. W. (1960). Glutamic acid decarboxylase. I. Isolation procedures and properties of the enzyme. The Journal of biological chemistry, 235, 1649–1652.<br>
 +
 +
</html>
  
 
<!-- -->
 
<!-- -->

Latest revision as of 09:08, 18 October 2021


Usage and Biology

Background: To improve the part BBa_K1378001, we mutated the gene gadB of 2019_SCUT ( BBa_K1378001) and tried to characterize GadB and GadB(mut) in different pH value. Then results of the two parts are compared. We first construct the plasmid T7 promoter-gadB(mut) below.

Design: Because we had successfully constructed the composite part (Lac-gadB(mut)-lac-gdhA-T1/ BBa_K3875007), so we can directly remove the gene gadB(mut) from Lac-gadB(mut)-lac-gdhA-T1 ( BBa_K3875007) with Primer 1 (CTTGAGACCTCCTTCTTAAAGTTAAAC) and Primer 3 (CAAGGGGTTATGCTAGTTATTGCTCTTAGTGATCGCTGAGATATTTCAGG).
After PCR amplification, pET30-gadB(mut) and a had the same cohesive end by restriction endonuclease, and then they were connected by T7 ligase. Finally, the linked plasmid was transformed into E. coli DH5a.
After the Polymerase Chain Reaction, the gene run a gel.

As we can see from this picture, number 9,13,15 is the proper gadB(mut) that we need.

In order to detect the expression of recombinant gene, the plasmid containing pET30-gadB(mut) was transformed into E. coli DH5a for fermentation (In fact, we didn't do it because of time constraints).
After that, we plan to purify the protein GadB (mut) and detect the protein activity of GadB in different pH value.
Our assumption is that our GadB (mut) would remain active at different pH, instead of just being active in pH 4.5.




Reference: [1] Gut, H., Pennacchietti, E., John, R. A., Bossa, F., Capitani, G., De Biase, D., & Grütter, M. G. (2006). Escherichia coli acid resistance: pH-sensing, activation by chloride and autoinhibition in GadB. The EMBO journal, 25(11), 2643–2651. https://doi.org/10.1038/sj.emboj.7601107
[2] Chae, T. U., Ko, Y. S., Hwang, K. S., & Lee, S. Y. (2017). Metabolic engineering of Escherichia coli for the production of four-, five- and six-carbon lactams. Metabolic engineering, 41, 82–91. https://doi.org/10.1016/j.ymben.2017.04.001
[3] SHUKUYA, R., & SCHWERT, G. W. (1960). Glutamic acid decarboxylase. I. Isolation procedures and properties of the enzyme. The Journal of biological chemistry, 235, 1649–1652.

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal AgeI site found at 758
  • 1000
    COMPATIBLE WITH RFC[1000]