Difference between revisions of "Part:BBa K143012:Design"

m (References)
(Design Notes)
 
(9 intermediate revisions by 3 users not shown)
Line 1: Line 1:
 
__NOTOC__
 
__NOTOC__
<partinfo>BBa_K143012 short</partinfo>
+
===<big>Promoter veg; a constitutive promoter for ''B. subtilis''</big>===
 +
 
 +
<br>
  
 
<partinfo>BBa_K143012 SequenceAndFeatures</partinfo>
 
<partinfo>BBa_K143012 SequenceAndFeatures</partinfo>
Line 6: Line 8:
  
 
===Design Notes===
 
===Design Notes===
The biobrick part was designed to include a single binding site for the ''B.subtilis major sigma factor. In addition the biobrick standard was applied to the promoter Pveg sequence.
+
 
 +
The Pveg promoter was suggested to us by Dr. Jan-Willem Veening, Institute for Cell and Molecular Bioscience, Newcastle University. The biobrick part was designed to include a single binding site for the ''B. subtilis'' major sigma factor A. In addition the biobrick prefix and suffix standards were applied to the promoter Pveg sequence.
 +
 
 +
The original design of this part was never made as an independent piece of DNA, but rather fused with an RBS and fabricated by Geneart as part K143052.  These primers are to create the part as an independent Biobrick:
 +
 
 +
GTTTCTTC GAATTC GCGGCCGC T TCTAGA G aattttgtcaaaataattttattgacaacg,K143012-F
 +
 
 +
GTTTCTTC CTGCAG CGGCCGC T ACTAGT Aacatttattgtacaacacgagcc,K143012-R
  
  
 +
Tom Knight 6 April 09
  
 
===Source===
 
===Source===
  
The Pveg promoter was suggested to us by Dr. Jan-Willem Veening of Newcastle University. The sequence supplied was compared to that of the DBTBS database<cite>#3</cite> then a section containing the binding site synthesised by Geneart.
+
The sequence supplied was compared to that of the DBTBS database<cite>#1</cite> then a section containing the binding site synthesised by Geneart.
  
 
===References===
 
===References===

Latest revision as of 20:56, 6 April 2009

Promoter veg; a constitutive promoter for B. subtilis



Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]


Design Notes

The Pveg promoter was suggested to us by Dr. Jan-Willem Veening, Institute for Cell and Molecular Bioscience, Newcastle University. The biobrick part was designed to include a single binding site for the B. subtilis major sigma factor A. In addition the biobrick prefix and suffix standards were applied to the promoter Pveg sequence.

The original design of this part was never made as an independent piece of DNA, but rather fused with an RBS and fabricated by Geneart as part K143052. These primers are to create the part as an independent Biobrick:

GTTTCTTC GAATTC GCGGCCGC T TCTAGA G aattttgtcaaaataattttattgacaacg,K143012-F

GTTTCTTC CTGCAG CGGCCGC T ACTAGT Aacatttattgtacaacacgagcc,K143012-R


Tom Knight 6 April 09

Source

The sequence supplied was compared to that of the DBTBS database#1 then a section containing the binding site synthesised by Geneart.

References

<biblio>

  1. 1 pmid=17962296

</biblio>