Difference between revisions of "Part:BBa K3970023"
 
(2 intermediate revisions by one other user not shown)
Line 1: Line 1:
 +
__NOTOC__
 +
<partinfo>BBa_K3970023 short</partinfo>
 +
 +
==Usage and Biology==
 
CpcF encodes phycocyanin alpha Phycocyanobilin lyase which is one part of the Phycocyanobilin lyase catalyzing alpha phycocyanin and 3Z-phycocyanobilin.Phycocyanobilin lyase is required for the chromophorylation of α-phycocyanin to form holo-α-subunit.
 
CpcF encodes phycocyanin alpha Phycocyanobilin lyase which is one part of the Phycocyanobilin lyase catalyzing alpha phycocyanin and 3Z-phycocyanobilin.Phycocyanobilin lyase is required for the chromophorylation of α-phycocyanin to form holo-α-subunit.
 +
 
In order to get our gene comes from Synechococcus lividus PCC 6715 chromosome, which is a kind of heat-resistant algae. We use other species’s CpcE gene to blast it on NCBI and fortunately we find gene CpcE whose source is PCC 6715.
 
In order to get our gene comes from Synechococcus lividus PCC 6715 chromosome, which is a kind of heat-resistant algae. We use other species’s CpcE gene to blast it on NCBI and fortunately we find gene CpcE whose source is PCC 6715.
 +
 +
==Construction==
 +
We use primer:GAP-cpcF-up and primer:CYC1-dn to get the fragment of CpcE+CYC1.
 +
 +
(For the cpcE sequence is synthesized by the company and as you know the single sequence is not stable so the company suggest us to directly synthesized it on the plasmid. It occurred that there is a CYC1 termination follows the CpcF sequence, so we just have to do one PCR too get two sequence. )
 +
 +
We use primer:homo-GAP-up and primer:GAP-dn to get the fragment of GAP.
 +
 +
[[File:0023-1.png|600px|thumb|center]]
 +
 +
[[File:0023-2.png|600px|thumb|center]]
 +
 +
<b>Primers we use to construct cpcE expression cassette:</b>
 +
 +
GAP-cpcF-up: attagatctcgccaccatgccTATGGCGGCGCTGCAACTTC
 +
 +
CYC1-dn: ggccgcaaattaaagccttcgag
 +
 +
homo-GAP-up: tcgctccccatttctctagtcattatcaatactgccatttcaaagaat
 +
 +
GAP-dn: ggcatggtggcgagatctaat
 +
 +
==Experiment results==
 +
[[File:0019-3.png|600px|thumb|center|The fragments of the constructed plasmid were recovered]]
 +
 +
<div style="text-align:center;"><b>M:  Marker<br>1-4:  CYC1(terminator)<br>5-8:  cpcE<br>9:  GAP (promoter)<br>10-13  : cpcF<br>14-17  :cpcA</b></div>
 +
 +
The picture shows how we use corresponding primers to get the expression cassette of cpcF.
 +
 +
<span class='h3bb'>Sequence and Features</span>
 +
<partinfo>BBa_K3970023 SequenceAndFeatures</partinfo>
 +
 +
 +
<!-- Uncomment this to enable Functional Parameter display
 +
===Functional Parameters===
 +
<partinfo>BBa_K3970023 parameters</partinfo>
 +
<!-- -->

Latest revision as of 14:19, 14 October 2021

pGAP-CpcF-tCYC1

Usage and Biology

CpcF encodes phycocyanin alpha Phycocyanobilin lyase which is one part of the Phycocyanobilin lyase catalyzing alpha phycocyanin and 3Z-phycocyanobilin.Phycocyanobilin lyase is required for the chromophorylation of α-phycocyanin to form holo-α-subunit.

In order to get our gene comes from Synechococcus lividus PCC 6715 chromosome, which is a kind of heat-resistant algae. We use other species’s CpcE gene to blast it on NCBI and fortunately we find gene CpcE whose source is PCC 6715.

Construction

We use primer:GAP-cpcF-up and primer:CYC1-dn to get the fragment of CpcE+CYC1.

(For the cpcE sequence is synthesized by the company and as you know the single sequence is not stable so the company suggest us to directly synthesized it on the plasmid. It occurred that there is a CYC1 termination follows the CpcF sequence, so we just have to do one PCR too get two sequence. )

We use primer:homo-GAP-up and primer:GAP-dn to get the fragment of GAP.

0023-1.png
0023-2.png

Primers we use to construct cpcE expression cassette:

GAP-cpcF-up: attagatctcgccaccatgccTATGGCGGCGCTGCAACTTC

CYC1-dn: ggccgcaaattaaagccttcgag

homo-GAP-up: tcgctccccatttctctagtcattatcaatactgccatttcaaagaat

GAP-dn: ggcatggtggcgagatctaat

Experiment results

The fragments of the constructed plasmid were recovered
M: Marker
1-4: CYC1(terminator)
5-8: cpcE
9: GAP (promoter)
10-13  : cpcF
14-17  :cpcA

The picture shows how we use corresponding primers to get the expression cassette of cpcF.

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]