Difference between revisions of "Help:BioBrick Prefix and Suffix"
(→Part Sequence) |
(→Part Sequence) |
||
| Line 8: | Line 8: | ||
===Part Sequence=== | ===Part Sequence=== | ||
The DNA sequence for parts in the Registry starts with the first base of the part itself and ends with its last base. | The DNA sequence for parts in the Registry starts with the first base of the part itself and ends with its last base. | ||
| − | For example, a protein coding sequence is like this "ATG----------TAATAA". (Note: if you want to use your protein part with BioScaffold parts [https://parts.igem.org/BioScaffold_Parts] to do things like directly make protein fusions from your part, then you should make a version of your part that has only one stop codon "ATG----------TAA" instead of two.) The sequence in the Registry does not include | + | For example, a protein coding sequence is like this "ATG----------TAATAA". (Note: if you want to use your protein part with BioScaffold parts [https://parts.igem.org/BioScaffold_Parts] to do things like directly make protein fusions from your part [http://openwetware.org/wiki/The_BioBricks_Foundation:BBFRFC15], then you should make a version of your part that has only one stop codon "ATG----------TAA" instead of two.) The sequence in the Registry does not include |
any bases of the BioBrick Prefix or Suffix. | any bases of the BioBrick Prefix or Suffix. | ||
Revision as of 09:45, 29 January 2009
Contents
Basic Information
|
|
For more information about how the prefix and suffix were determined and the special case of coding regions, see Assembly:RBS-CDS_issues. |
Part Sequence
The DNA sequence for parts in the Registry starts with the first base of the part itself and ends with its last base. For example, a protein coding sequence is like this "ATG----------TAATAA". (Note: if you want to use your protein part with BioScaffold parts [1] to do things like directly make protein fusions from your part [http://openwetware.org/wiki/The_BioBricks_Foundation:BBFRFC15], then you should make a version of your part that has only one stop codon "ATG----------TAA" instead of two.) The sequence in the Registry does not include any bases of the BioBrick Prefix or Suffix.
Plasmids (see below) and primers or tags that explicitly specify prefix or suffix bases are exceptions to this rule.
BioBrick Prefix
The standard BioBrick prefix depends on the part that follows it.
|
If the following part is a coding sequence or any other part that starts "ATG", the BioBrick prefix is: |
gaattcgcggccgcttctag
|
|
Otherwise, the BioBrick prefix is: |
gaattcgcggccgcttctagag
|
BioBrick Suffix
|
The standard BioBrick suffix is always: |
tactagtagcggccgctgcag
|
BioBrick Scar
When BioBricks with these prefix and suffix sequencees are assembled, there is a "scar" between these parts.
|
If the second part starts "AT", the scar is: |
tactag
|
|
Otherwise, the scar is: |
tactagag
|