Difference between revisions of "Part:pSB1A2"

 
 
(4 intermediate revisions by 2 users not shown)
Line 1: Line 1:
 
 
__NOTOC__
 
__NOTOC__
 
<partinfo>pSB1A2 short</partinfo>
 
<partinfo>pSB1A2 short</partinfo>
Line 8: Line 7:
 
pSB1A2 has one terminator upstream of its MCS, which is oriented to prevent transcription from *inside* the MCS from reading out into any DNA outside the MCS. The orientation of the pBLA promoter driving the AmpR gene is such that relatively little transcription should be coming into the MCS from upstream. Ideally, a future version of the standard biobrick vectors would have terminators bracketing an MCS that were 100% efficient in terminating both into and out of the MCS region.
 
pSB1A2 has one terminator upstream of its MCS, which is oriented to prevent transcription from *inside* the MCS from reading out into any DNA outside the MCS. The orientation of the pBLA promoter driving the AmpR gene is such that relatively little transcription should be coming into the MCS from upstream. Ideally, a future version of the standard biobrick vectors would have terminators bracketing an MCS that were 100% efficient in terminating both into and out of the MCS region.
  
 +
<!-- Add more about the biology of this part here
 
===Usage and Biology===
 
===Usage and Biology===
-- Please enter your experience with this part here --
 
  
 +
<!-- -->
 
<span class='h3bb'>Sequence and Features</span>
 
<span class='h3bb'>Sequence and Features</span>
 
<partinfo>pSB1A2 SequenceAndFeatures</partinfo>
 
<partinfo>pSB1A2 SequenceAndFeatures</partinfo>
  
 +
 +
<!-- Uncomment this to enable Functional Parameter display
 
===Functional Parameters===
 
===Functional Parameters===
 
<partinfo>pSB1A2 parameters</partinfo>
 
<partinfo>pSB1A2 parameters</partinfo>
 +
<!-- -->
 +
 +
 +
 +
=== sequence between EcoRI and XbaI ===
 +
The sequence in iGEM database is
 +
 +
GAATTCGCGGCCGC<font color="red">A</font>TCTAGA ,
 +
but isn't it
 +
 +
GAATTCGCGGCCGC<font color="red">T</font>TCTAGA ?
 +
 +
--[[User:MaRui|marion]] 08:50, 19 June 2008 (UTC)
 +
!!! Marion is right and I fixed it - Randy

Latest revision as of 21:21, 2 November 2008

pSB1A2 (Replaced by pSB1A3)

pSB1A2 is a high copy number plasmid carrying ampicillin resistance. The replication origin is a pUC19-derived pMB1 (copy number of 100-300 per cell).

pSB1A2 has one terminator upstream of its MCS, which is oriented to prevent transcription from *inside* the MCS from reading out into any DNA outside the MCS. The orientation of the pBLA promoter driving the AmpR gene is such that relatively little transcription should be coming into the MCS from upstream. Ideally, a future version of the standard biobrick vectors would have terminators bracketing an MCS that were 100% efficient in terminating both into and out of the MCS region.

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    INCOMPATIBLE WITH RFC[12]
    Plasmid lacks a prefix.
    Plasmid lacks a suffix.
    Illegal EcoRI site found at 2058
    Illegal SpeI site found at 2
    Illegal PstI site found at 16
    Illegal NotI site found at 9
    Illegal NotI site found at 2064
  • 21
    INCOMPATIBLE WITH RFC[21]
    Plasmid lacks a prefix.
    Plasmid lacks a suffix.
    Illegal EcoRI site found at 2058
  • 23
    INCOMPATIBLE WITH RFC[23]
    Illegal prefix found at 2058
    Illegal suffix found at 2
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal prefix found at 2058
    Plasmid lacks a suffix.
    Illegal XbaI site found at 2073
    Illegal SpeI site found at 2
    Illegal PstI site found at 16
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Plasmid lacks a prefix.
    Plasmid lacks a suffix.
    Illegal BsaI.rc site found at 1097



sequence between EcoRI and XbaI

The sequence in iGEM database is

GAATTCGCGGCCGCATCTAGA , but isn't it

GAATTCGCGGCCGCTTCTAGA ?

--marion 08:50, 19 June 2008 (UTC) !!! Marion is right and I fixed it - Randy