Difference between revisions of "Part:BBa K165037:Design"
 
(One intermediate revision by the same user not shown)
Line 19: Line 19:
  
  
−
Here are the primers we used:
+
Here are the primers we used:<br>
  
−
''example: spacer + biobrick prefeix + homologous to yeast genome''
+
''example: spacer + biobrick prefeix + homologous to yeast genome''<br>
  
−
TEF.fwd:  GTTTCTT + attacccataaggttgtttgtgacgg + agcgttggttggtggatcaag
+
TEF.fwd:  GTTTCTT + attacccataaggttgtttgtgacgg + agcgttggttggtggatcaag<br>
  
−
''example: homologous to yeast genome + biobrick suffix + spacer''
+
''example: homologous to yeast genome + biobrick suffix + spacer''<br>
  
−
TEF.rev:  cggtcaacgaactataattaacta + tactagtagcggccgctgcag + AAGAAAC
+
TEF.rev:  cggtcaacgaactataattaacta + tactagtagcggccgctgcag + AAGAAAC<br>
  
  
−
To do whole-cell PCR, we prepared a reaction with double the normal magnesium and no template
+
To do whole-cell PCR, we prepared a reaction with double the normal magnesium and no template<br><br>
  
−
10 ul 5x PCR buffer
+
10 ul 5x PCR buffer<br>
−
6 uL 25 mM MgCl2
+
6 uL 25 mM MgCl2<br>
−
1 ul 20 uM TEF.fwd primer
+
1 ul 20 uM TEF.fwd primer<br>
−
1 ul 20 uM TEF.rev primer
+
1 ul 20 uM TEF.rev primer<br>
−
1 ul 10 mM (each) dNTP mix
+
1 ul 10 mM (each) dNTP mix<br>
−
.25 ul  Taq polymerase
+
.25 ul  Taq polymerase<br>
−
31.75 ul cartridge-purified water
+
31.75 ul cartridge-purified water<br><br>
  
 
We took a small spot of cells off of a fresh plate of W303a with a 200uL pipette tip, and ground them against the bottom of the reaction tube with the tip.  This is not the time to be dainty- the idea is to break open the cells with physical force.
 
We took a small spot of cells off of a fresh plate of W303a with a 200uL pipette tip, and ground them against the bottom of the reaction tube with the tip.  This is not the time to be dainty- the idea is to break open the cells with physical force.
  
−
We ran the reaction with the following program:
+
We ran the reaction with the following program:<br>
−
95C- 5 min
+
95C- 5 min<br>
−
30 cycles of-[
+
30 cycles of-[<br>
−
95C- 30s
+
95C- 30s<br>
−
45C- 60s
+
45C- 60s<br>
−
68C- 2 min
+
68C- 2 min<br>
−
]
+
]<br>
−
68C- 5min
+
68C- 5min<br>
  
 
We got a faint nonspecific product that was longer than the expected product, so gel extracted the expected product before ligating onto pSB1AK3.
 
We got a faint nonspecific product that was longer than the expected product, so gel extracted the expected product before ligating onto pSB1AK3.

Latest revision as of 19:29, 2 November 2008

TEF2 yeast constitutive promoter


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]


Design Notes

-


Source

Amplified from the yeast genome (strain W303a) by Brown iGEM using promoter definition from:

Mumberg, Muller, and Funk: http://dx.doi.org/10.1016/0378-1119(95)00037-7


Here are the primers we used:

example: spacer + biobrick prefeix + homologous to yeast genome

TEF.fwd: GTTTCTT + attacccataaggttgtttgtgacgg + agcgttggttggtggatcaag

example: homologous to yeast genome + biobrick suffix + spacer

TEF.rev: cggtcaacgaactataattaacta + tactagtagcggccgctgcag + AAGAAAC


To do whole-cell PCR, we prepared a reaction with double the normal magnesium and no template

10 ul 5x PCR buffer
6 uL 25 mM MgCl2
1 ul 20 uM TEF.fwd primer
1 ul 20 uM TEF.rev primer
1 ul 10 mM (each) dNTP mix
.25 ul Taq polymerase
31.75 ul cartridge-purified water

We took a small spot of cells off of a fresh plate of W303a with a 200uL pipette tip, and ground them against the bottom of the reaction tube with the tip. This is not the time to be dainty- the idea is to break open the cells with physical force.

We ran the reaction with the following program:
95C- 5 min
30 cycles of-[
95C- 30s
45C- 60s
68C- 2 min
]
68C- 5min

We got a faint nonspecific product that was longer than the expected product, so gel extracted the expected product before ligating onto pSB1AK3.


References