Difference between revisions of "Collections/BIOFAB"
(→Modular Promoter Library) |
|||
Line 45: | Line 45: | ||
− | <table id="modular-promoter-library-chart" class="charts-css column show-labels"> | + | <table id="modular-promoter-library-chart" class="charts-css column show-labels show-primary-axis"> |
<tr> | <tr> | ||
<th scope="row">apFAB1</th> | <th scope="row">apFAB1</th> |
Revision as of 00:16, 21 August 2021
Undergoing curation by the 2021 FSU iGEM team...
How is the BIOFAB collection useful to you?
The BIOFAB collection contains over 250 promoters that are registered BioBricks parts. The promoters have a range of relative expression that spans four orders of magnitude. Promoters of different strengths can be selected from the BIOFAB collection based on desired expression levels. This allows the promoter strength to be varied when designing genetic constructs by selecting a promoter with a different relative strength. The BIOFAB promoters do not always display the expected expression strength. The observed expression strength is thought to vary depending on the genetic context. To ensure that a promoter with the desired strength is selected, the design should be tested with several different promoters of similar strengths. Using multiple promoters increases the likelihood that at least one promoter will display the desired strength.
How does it work?
The promoters on this page are listed in order of decreasing strength. The strongest promoters produce the most RNA transcripts of their downstream gene, while the weakest promoters produce the fewest RNA transcripts. The promoter strength is determined by how strongly the DNA sequence recruits RNA polymerase. Stronger promoters are better able to recruit RNA polymerase, so they cause transcription to occur more frequently. Weaker promoters cannot recruit RNA polymerase as effectively, so they cause transcription to occur less frequently.
How was it built?
The 2018 FSU iGEM team measured the expression levels of three BIOFAB promoters in iGEM plasmids. A test device was created, which contained a BIOFAB promoter, a ribosome binding site (part B0034), a red fluorescent protein (part mRFP1 E1010), and a double terminator(part B0015). (make the names of these parts hyperlinks to their webpages) The test device was incorporated into the plasmid pSB1C3, which gives transformed bacteria resistance to chloramphenicol.
[plasmid map]
The test device was created by combining the pSB1C3 backbone with two overlapping DNA inserts. The first insert contained the biobrick prefix, the BIOFAB promoter, and part of the mRFP1 gene. The second insert contained the full mRFP1 gene, the double terminator, and the biobrick suffix. The three DNA sequences were then combined into one plasmid using the NEB Hifi DNA Assembly Master Mix protocol. This procedure combines multiple pieces of DNA that share overlapping sequences into a single DNA molecule. The partial mRFP1 sequence on the first insert overlaps with the full mRFP1 gene on the second insert, so the Hifi Assembly method combines the two inserts into a single DNA oligo. The combined insert begins with a biobrick prefix and ends with a biobrick suffix, which overlap with the prefix and suffix that are found on the plasmid. Once the insert is assembled into the plasmid, the final plasmid is complete.
References
Mutalik, V., Guimaraes, J., Cambray, G. et al. Precise and reliable gene expression via standard transcription and translation initiation elements. Nat Methods 10, 354–360 (2013). https://doi.org/10.1038/nmeth.2404
BIOFAB Collection
Modular Promoter Library
apFAB1 | 897.6 |
---|---|
apFAB2 | 866.6 |
apFAB3 | 866.3 |
iGEM Registry Name | BIOFAB ID | Strength (mean fluorescence per cell) |
---|---|---|
BBa_M36303 | apFAB46 | 897.636 |
BBa_K2832101 | apFAB70 | 866.671 |
BBa_K2832102 | apFAB71 | 866.296 |
BBa_K2832103 | apFAB61 | 857.927 |
BBa_K2832104 | apFAB80 | 787.199 |
BBa_K2832105 | apFAB45 | 785.309 |
BBa_K2832106 | apFAB47 | 782.004 |
BBa_K2832107 | apFAB31 | 781.826 |
BBa_K2832108 | apFAB55 | 768.983 |
BBa_K2832109 | apFAB68 | 766.301 |
BBa_K2832110 | apFAB101 | 757.959 |
BBa_K2832111 | apFAB96 | 748.822 |
BBa_K2832112 | apFAB56 | 743.476 |
BBa_K2832113 | apFAB81 | 742.631 |
BBa_K2832114 | apFAB92 | 742.334 |
BBa_K2832115 | apFAB72 | 737.59 |
BBa_K2832116 | apFAB100 | 736.966 |
BBa_K2832117 | apFAB76 | 736.51 |
BBa_K2832118 | apFAB30 | 731.463 |
BBa_K2832119 | apFAB79 | 728.654 |
BBa_K2832120 | apFAB75 | 717.72 |
BBa_K2832121 | apFAB50 | 707.166 |
BBa_K2832122 | apFAB93 | 706.957 |
BBa_K2832123 | apFAB60 | 700.31 |
BBa_K2832124 | apFAB54 | 690.839 |
BBa_K2832125 | apFAB62 | 687.948 |
BBa_K2832126 | apFAB42 | 685.34 |
BBa_K2832127 | apFAB53 | 682.888 |
BBa_K2832128 | apFAB85 | 674.421 |
BBa_K2832129 | apFAB65 | 670.065 |
BBa_K2832130 | apFAB52 | 666.998 |
BBa_K2832131 | apFAB67 | 649.993 |
BBa_K2832132 | apFAB32 | 645.519 |
BBa_K2832133 | apFAB57 | 637.488 |
BBa_K2832134 | apFAB39 | 594.378 |
BBa_K2832135 | apFAB115 | 573.792 |
BBa_K2832136 | apFAB29 | 565.946 |
BBa_K2832137 | apFAB77 | 555.565 |
BBa_K2832138 | apFAB36 | 547.956 |
BBa_K2832139 | apFAB44 | 540.856 |
BBa_K2832140 | apFAB102 | 534.826 |
BBa_K2832141 | apFAB37 | 530.604 |
BBa_K2832142 | apFAB41 | 523.35 |
BBa_K2832143 | apFAB63 | 518.502 |
BBa_K2832144 | apFAB140 | 508.942 |
BBa_K2832145 | apFAB64 | 508.117 |
BBa_K2832146 | apFAB40 | 488.364 |
BBa_K2832147 | apFAB97 | 477.744 |
BBa_K2832148 | apFAB78 | 476.327 |
BBa_K2832149 | apFAB69 | 474.513 |
BBa_K2832150 | apFAB103 | 459.253 |
BBa_K2832151 | apFAB73 | 456.758 |
BBa_K2832152 | apFAB66 | 439.276 |
BBa_K2832153 | apFAB126 | 433.829 |
BBa_K2832154 | apFAB95 | 425.407 |
BBa_K2832155 | apFAB151 | 422.838 |
BBa_K2832156 | apFAB48 | 411.861 |
BBa_K2832157 | apFAB82 | 389.529 |
BBa_K2832158 | apFAB141 | 376.932 |
BBa_K2832159 | apFAB150 | 366.498 |
BBa_K2832160 | apFAB125 | 363.199 |
BBa_K2832161 | apFAB33 | 340.476 |
BBa_K2832162 | apFAB121 | 328.946 |
BBa_K2832163 | apFAB111 | 327.288 |
BBa_K2832164 | apFAB58 | 287.687 |
BBa_K2832165 | apFAB94 | 279.605 |
BBa_K2832166 | apFAB145 | 271.14 |
BBa_K2832167 | apFAB118 | 267.819 | BBa_K2832168 | apFAB106 | 256.824 |
BBa_K2832169 | apFAB110 | 254.676 |
BBa_K2832170 | apFAB105 | 243.758 |
BBa_K2832171 | apFAB38 | 239.875 |
BBa_K2832172 | apFAB89 | 223.766 |
BBa_K2832173 | apFAB142 | 214.923 |
BBa_K2832174 | apFAB130 | 182.202 |
BBa_K2832175 | apFAB131 | 167.803 |
BBa_K2832176 | apFAB143 | 157.015 |
BBa_K2832177 | apFAB87 | 145.215 |
BBa_K2832178 | apFAB104 | 126.832 |
BBa_K2832179 | apFAB98 | 120.521 |
BBa_K2832180 | apFAB51 | 103.187 |
BBa_K2832181 | apFAB49 | 93.9231 |
BBa_K2832182 | apFAB120 | 81.7515 |
BBa_K2832183 | apFAB83 | 79.3039 |
BBa_K2832184 | apFAB117 | 62.9585 |
BBa_K2832185 | apFAB129 | 60.7537 |
BBa_K2832186 | apFAB146 | 58.9582 |
BBa_K2832187 | apFAB59 | 58.498 |
BBa_K2832188 | apFAB127 | 48.3838 |
BBa_K2832189 | apFAB88 | 48.354 |
BBa_K2832190 | apFAB86 | 44.6204 |
BBa_K2832191 | apFAB74 | 44.6094 |
BBa_K2832192 | apFAB152 | 40.7219 |
BBa_K2832193 | apFAB122 | 36.8209 |
BBa_K2832194 | apFAB128 | 26.6541 |
BBa_K2832195 | apFAB99 | 26.5471 |
BBa_K2832196 | apFAB119 | 20.866 |
BBa_K2832197 | apFAB112 | 17.3114 |
BBa_K2832198 | apFAB34 | 14.6339 |
BBa_K2832199 | apFAB147 | 13.3236 |
BBa_K2832200 | apFAB144 | 13.0792 |
BBa_K2832201 | apFAB35 | 12.6234 |
BBa_K2832202 | apFAB107 | 11.4242 |
BBa_K2832203 | apFAB123 | 11.2076 |
BBa_K2832204 | apFAB137 | 7.09512 |
BBa_K2832205 | apFAB113 | 5.32229 |
BBa_K2832206 | apFAB84 | 4.73181 |
BBa_K2832207 | apFAB148 | 4.01421 |
BBa_K2832208 | apFAB108 | 3.64128 |
BBa_K2832209 | apFAB114 | 3.35398 |
BBa_K2832210 | apFAB136 | 3.19915 |
BBa_K2832211 | apFAB124 | 2.64681 |
BBa_K2832212 | apFAB149 | 2.52982 |
BBa_K2832213 | apFAB134 | 2.52663 |
BBa_K2832214 | apFAB138 | 1.64153 |
BBa_K2832215 | apFAB43 | 1.0947 |
BBa_K2832216 | apFAB133 | 0.84608 |
BBa_K2832217 | apFAB139 | 0.681873 |
BBa_K2832218 | apFAB91 | 0.42395 |
BBa_K2832219 | apFAB90 | 0.378777 |
Randomized Promoter Library
Parts Registry Name | BIOFAB ID | Strength (mean fluorescence per cell) |
---|---|---|
BBa_J97008 | apFAB342 | 740.35 |
BBa_K3702000 | apFAB347 | 738.40 |
BBa_K3702001 | apFAB345 | 714.53 |
BBa_K3702002 | apFAB341 | 668.45 |
BBa_K3702003 | apFAB317 | 654.56 |
BBa_K3702004 | apFAB338 | 615.44 |
BBa_K3702005 | apFAB323 | 611.20 |
BBa_K3702006 | apFAB339 | 580.23 |
BBa_K3702007 | apFAB321 | 557.04 |
BBa_K3702008 | apFAB340 | 538.51 |
BBa_K3702009 | apFAB322 | 516.83 |
BBa_K3702010 | apFAB346 | 466.88 |
BBa_K3702011 | apFAB303 | 345.31 |
BBa_K3702012 | apFAB302 | 342.55 |
BBa_K3702013 | apFAB297 | 339.75 |
BBa_K3702014 | apFAB301 | 338.31 |
BBa_K3702015 | apFAB298 | 327.52 |
BBa_K3702016 | apFAB306 | 307.03 |
BBa_K3702017 | apFAB307 | 283.99 |
BBa_K3702018 | apFAB296 | 277.56 |
BBa_K3702019 | apFAB308 | 269.83 |
BBa_K3702020 | apFAB295 | 252.47 |
BBa_K3702021 | apFAB300 | 246.62 |
BBa_K3702022 | apFAB299 | 203.95 |
BBa_K3702023 | apFAB309 | 199.95 |
BBa_K3702024 | apFAB305 | 164.05 |
BBa_K3702025 | apFAB313 | 160.29 |
BBa_K3702026 | apFAB310 | 156.73 |
BBa_K3702027 | apFAB311 | 155.52 |
BBa_K3702028 | apFAB279 | 145.82 |
BBa_K3702029 | apFAB314 | 141.99 |
BBa_K3702030 | apFAB281 | 139.88 |
BBa_K3702031 | apFAB276 | 138.28 |
BBa_K3702032 | apFAB312 | 135.53 |
BBa_K3702033 | apFAB273 | 128.84 |
BBa_K3702034 | apFAB316 | 123.38 |
BBa_K3702035 | apFAB282 | 105.12 |
BBa_K3702036 | apFAB260 | 99.29 |
BBa_K3702037 | apFAB293 | 98.98 |
BBa_K3702038 | apFAB259 | 95.97 |
BBa_K3702039 | apFAB284 | 77.82 |
BBa_K3702040 | apFAB285 | 76.92 |
BBa_K3702041 | apFAB286 | 76.12 |
BBa_K3702042 | apFAB257 | 75.39 |
BBa_K3702043 | apFAB267 | 74.39 |
BBa_K3702044 | apFAB263 | 70.05 |
BBa_K3702045 | apFAB262 | 65.83 |
BBa_K3702046 | apFAB265 | 63.55 |
BBa_K3702047 | apFAB271 | 59.33 |
BBa_K3702048 | apFAB278 | 58.41 |
BBa_K3702049 | apFAB241 | 57.40 |
BBa_K3702050 | apFAB280 | 57.40 |
BBa_K3702051 | apFAB254 | 57.29 |
BBa_K3702052 | apFAB266 | 56.78 |
BBa_K3702053 | apFAB270 | 55.67 |
BBa_K3702054 | apFAB287 | 52.53 |
BBa_K3702055 | apFAB256 | 49.71 |
BBa_K3702056 | apFAB253 | 49.10 |
BBa_K3702057 | apFAB264 | 48.80 |
BBa_K3702058 | apFAB337 | 48.57 |
BBa_K3702059 | apFAB261 | 47.13 |
BBa_K3702060 | apFAB272 | 45.89 |
BBa_K3702061 | apFAB274 | 44.90 |
BBa_K3702062 | apFAB258 | 39.55 |
BBa_K3702063 | apFAB255 | 38.32 |
BBa_K3702064 | apFAB268 | 38.05 |
BBa_K3702065 | apFAB333 | 34.24 |
BBa_K3702066 | apFAB326 | 33.51 |
BBa_K3702067 | apFAB343 | 33.50 |
BBa_K3702068 | apFAB329 | 33.21 |
BBa_K3702069 | apFAB332 | 32.73 |
BBa_K3702070 | apFAB252 | 32.49 |
BBa_K3702071 | apFAB251 | 30.07 |
BBa_K3702072 | apFAB226 | 29.25 |
BBa_K3702073 | apFAB315 | 25.64 |
BBa_K3702074 | apFAB335 | 21.55 |
BBa_K3702075 | apFAB334 | 21.08 |
BBa_K3702076 | apFAB319 | 20.39 |
BBa_K3702077 | apFAB229 | 15.31 |
BBa_K3702078 | apFAB228 | 14.36 |
BBa_K3702079 | apFAB225 | 13.71 |
BBa_K3702080 | apFAB224 | 13.10 |
BBa_K3702081 | apFAB324 | 12.77 |
BBa_K3702082 | apFAB230 | 12.69 |
BBa_K3702083 | apFAB318 | 12.62 |
BBa_K3702084 | apFAB331 | 11.14 |
BBa_K3702085 | apFAB304 | 10.75 |
BBa_K3702086 | apFAB231 | 10.58 |
BBa_K3702087 | apFAB227 | 9.46 |
BBa_K3702088 | apFAB209 | 8.05 |
BBa_K3702089 | apFAB202 | 5.83 |
BBa_K3702090 | apFAB212 | 5.57 |
BBa_K3702091 | apFAB211 | 5.30 |
BBa_K3702092 | apFAB221 | 4.87 |
BBa_K3702093 | apFAB205 | 4.80 |
BBa_K3702094 | apFAB201 | 4.75 |
BBa_K3702095 | apFAB193 | 4.48 |
BBa_K3702096 | apFAB203 | 4.46 |
BBa_K3702097 | apFAB200 | 4.41 |
BBa_K3702098 | apFAB207 | 4.26 |
BBa_K3702099 | apFAB206 | 4.20 |
BBa_K3702100 | apFAB194 | 4.17 |
BBa_K3702101 | apFAB208 | 4.17 |
BBa_K3702102 | apFAB181 | 4.00 |
BBa_K3702103 | apFAB204 | 3.85 |
BBa_K3702104 | apFAB190 | 3.75 |
BBa_K3702105 | apFAB189 | 3.69 |
BBa_K3702106 | apFAB184 | 3.62 |
BBa_K3702107 | apFAB215 | 3.44 |
BBa_K3702108 | apFAB168 | 3.33 |
BBa_K3702109 | apFAB197 | 3.28 |
BBa_K3702110 | apFAB199 | 3.27 |
BBa_K3702111 | apFAB216 | 3.09 |
BBa_K3702112 | apFAB180 | 2.98 |
BBa_K3702113 | apFAB187 | 2.97 |
BBa_K3702114 | apFAB182 | 2.94 |
BBa_K3702115 | apFAB186 | 2.92 |
BBa_K3702116 | apFAB183 | 2.76 |
BBa_K3702117 | apFAB195 | 2.73 |
BBa_K3702118 | apFAB167 | 2.68 |
BBa_K3702119 | apFAB177 | 2.67 |
BBa_K3702120 | apFAB192 | 2.57 |
BBa_K3702121 | apFAB220 | 2.55 |
BBa_K3702122 | apFAB161 | 2.54 |
BBa_K3702123 | apFAB160 | 2.52 |
BBa_K3702124 | apFAB162 | 2.51 |
BBa_K3702125 | apFAB159 | 2.50 |
BBa_K3702126 | apFAB164 | 2.50 |
BBa_K3702127 | apFAB166 | 2.49 |
BBa_K3702128 | apFAB157 | 2.48 |
BBa_K3702129 | apFAB217 | 2.48 |
BBa_K3702130 | apFAB156 | 2.46 |
BBa_K3702131 | apFAB213 | 2.33 |
BBa_K3702132 | apFAB325 | 2.24 |
BBa_K3702133 | apFAB188 | 1.93 |
BBa_K3702134 | apFAB210 | 1.80 |
BBa_K3702135 | apFAB327 | 0.75 |
BBa_K3702136 | apFAB294 | 0.21 |
Terminator Library
iGEM Registry Name | BIOFAB ID | Termination Efficiency |
---|---|---|
BBa_K3702137 | apFAB352 | |
BBa_K3702138 | apFAB353 | |
BBa_K3702139 | apFAB354 | |
BBa_K3702140 | apFAB355 | |
BBa_K3702141 | apFAB356 | |
BBa_K3702142 | apFAB357 | |
BBa_K3702143 | apFAB358 | |
BBa_K3702144 | apFAB359 | |
BBa_K3702145 | apFAB360 | |
BBa_K3702146 | apFAB361 | |
BBa_K3702147 | apFAB362 | |
BBa_K3702148 | apFAB363 | |
BBa_K3702149 | apFAB364 | |
BBa_K3702150 | apFAB365 | |
BBa_K3702151 | apFAB366 | |
BBa_K3702152 | apFAB367 | |
BBa_K3702153 | apFAB368 | |
BBa_K3702154 | apFAB369 | |
BBa_K3702155 | apFAB370 | |
BBa_K3702156 | apFAB371 | |
BBa_K3702157 | apFAB372 | |
BBa_K3702158 | apFAB373 | |
BBa_K3702159 | apFAB374 | |
BBa_K3702160 | apFAB375 | |
BBa_K3702161 | apFAB376 | |
BBa_K3702162 | apFAB377 | |
BBa_K3702163 | apFAB378 | |
BBa_K3702164 | apFAB379 | |
BBa_K3702165 | apFAB380 | |
BBa_K3702166 | apFAB381 | |
BBa_K3702167 | apFAB382 | |
BBa_K3702168 | apFAB383 | |
BBa_K3702169 | apFAB384 | |
BBa_K3702170 | apFAB385 | |
BBa_K3702171 | apFAB386 | |
BBa_K3702172 | apFAB387 | |
BBa_K3702173 | apFAB388 | |
BBa_K3702174 | apFAB389 | |
BBa_K3702175 | apFAB390 | |
BBa_K3702176 | apFAB391 |
Modular Promoters Table Generated by the Registry
Name | Description | Type | Created by | length | uses | seq |
---|---|---|---|---|---|---|
BBa_K2832100 | BIOFAB Modular Promoter apFAB46 | Regulatory | BIOFAB | 47 | 1 | . . . cgcatctttttgtacctataatagattcat |
BBa_K2832101 | BIOFAB Modular Promoter apFAB70 | Regulatory | BIOFAB | 37 | . . . cgcatctttttgtacctataatgtgtggat | |
BBa_K2832102 | BIOFAB Modular Promoter apFAB71 | Regulatory | BIOFAB | 37 | . . . cgcatctttttgtacctataatagattcat | |
BBa_K2832103 | BIOFAB Modular Promoter apFAB61 | Regulatory | BIOFAB | 37 | . . . ttaatcatccggctcgtataatagattcat | |
BBa_K2832104 | BIOFAB Modular Promoter apFAB80 | Regulatory | BIOFAB | 49 | . . . aagtctaacctataggtataatgtgtggat | |
BBa_K2832105 | BIOFAB Modular Promoter apFAB45 | Regulatory | BIOFAB | 47 | . . . cgcatctttttgtacctataatgtgtggat | |
BBa_K2832106 | BIOFAB Modular Promoter apFAB47 | Regulatory | BIOFAB | 47 | . . . cgcatctttttgtacccataattatttcat | |
BBa_K2832107 | BIOFAB modular Promoter apFAB31 | Regulatory | BIOFAB | 48 | . . . aagtctaacctataggtataatagattcat | |
BBa_K2832108 | BIOFAB modular Promoter apFAB55 | Regulatory | BIOFAB | 38 | . . . aagtctaacctataggtataatgtgtggat | |
BBa_K2832109 | BIOFAB modular Promoter apFAB68 | Regulatory | BIOFAB | 37 | . . . caggaaaatttttctgtagatttaacgtat | |
BBa_K2832110 | BIOFAB modular Promoter apFAB101 | Regulatory | BIOFAB | 48 | . . . ttatcccttgcggcgatataatagattcat | |
BBa_K2832111 | BIOFAB Modular Promoter apFAB96 | Regulatory | BIOFAB | 48 | . . . cgcatctttttgtacctataatagattcat | |
BBa_K2832112 | BIOFAB Modular Promoter apFAB56 | Regulatory | BIOFAB | 38 | . . . aagtctaacctataggtataatagattcat | |
BBa_K2832113 | BIOFAB Modular Promoter apFAB81 | Regulatory | BIOFAB | 49 | . . . aagtctaacctataggtataatagattcat | |
BBa_K2832114 | BIOFAB Modular Promoter apFAB92 | Regulatory | BIOFAB | 48 | . . . caggaaaatttttctgcataattatttcat | |
BBa_K2832115 | BIOFAB Modular Promoter apFAB72 | Regulatory | BIOFAB | 37 | . . . cgcatctttttgtacccataattatttcat | |
BBa_K2832116 | BIOFAB Modular Promoter apFAB100 | Regulatory | BIOFAB | 48 | . . . ttatcccttgcggcgatataatgtgtggat | |
BBa_K2832117 | BIOFAB Modular Promoter apFAB76 | Regulatory | BIOFAB | 37 | . . . ttatcccttgcggcgatataatagattcat | |
BBa_K2832118 | BIOFAB Modular Promoter apFAB30 | Regulatory | BIOFAB | 48 | . . . aagtctaacctataggtataatgtgtggat | |
BBa_K2832119 | BIOFAB Modular Promoter apFAB79 | Regulatory | BIOFAB | 49 | . . . aagtctaacctataggatacttacagccat | |
BBa_K2832120 | BIOFAB Modular Promoter apFAB75 | Regulatory | BIOFAB | 37 | . . . ttatcccttgcggcgatataatgtgtggat | |
BBa_K2832121 | BIOFAB Modular Promoter apFAB50 | Regulatory | BIOFAB | 47 | . . . ttatcccttgcggcgatataatgtgtggat | |
BBa_K2832122 | BIOFAB Modular Promoter apFAB93 | Regulatory | BIOFAB | 48 | . . . caggaaaatttttctgtagatttaacgtat | |
BBa_K2832123 | BIOFAB Modular Promoter apFAB60 | Regulatory | BIOFAB | 37 | . . . ttaatcatccggctcgtataatgtgtggat | |
BBa_K2832124 | BIOFAB Modular Promoter apFAB54 | Regulatory | BIOFAB | 38 | . . . aagtctaacctataggatacttacagccat | |
BBa_K2832125 | BIOFAB Modular Promoter apFAB62 | Regulatory | BIOFAB | 37 | . . . ttaatcatccggctcgcataattatttcat | |
BBa_K2832126 | BIOFAB Modular Promoter apFAB42 | Regulatory | BIOFAB | 47 | . . . caggaaaatttttctgcataattatttcat | |
BBa_K2832127 | BIOFAB Modular Promoter apFAB53 | Regulatory | BIOFAB | 47 | . . . ttatcccttgcggcgatagatttaacgtat | |
BBa_K2832128 | BIOFAB Modular Promoter apFAB85 | Regulatory | BIOFAB | 48 | . . . ttaatcatccggctcgtataatgtgtggat | |
BBa_K2832129 | BIOFAB Modular Promoter apFAB65 | Regulatory | BIOFAB | 37 | . . . caggaaaatttttctgtataatgtgtggat | |
BBa_K2832130 | BIOFAB Modular Promoter apFAB52 | Regulatory | BIOFAB | 47 | . . . ttatcccttgcggcgacataattatttcat | |
BBa_K2832131 | BIOFAB Modular Promoter apFAB67 | Regulatory | BIOFAB | 37 | . . . caggaaaatttttctgcataattatttcat | |
BBa_K2832132 | BIOFAB Modular Promoter apFAB32 | Regulatory | BIOFAB | 48 | . . . aagtctaacctataggcataattatttcat | |
BBa_K2832133 | BIOFAB Modular Promoter apFAB57 | Regulatory | BIOFAB | 38 | . . . aagtctaacctataggcataattatttcat | |
BBa_K2832134 | BIOFAB Modular Promoter apFAB39 | Regulatory | BIOFAB | 47 | . . . caggaaaatttttctgatacttacagccat | |
BBa_K2832135 | BIOFAB Modular Promoter apFAB115 | Regulatory | BIOFAB | 37 | . . . caggaaaatttttctgtataatgtgtggat | |
BBa_K2832136 | BIOFAB Modular Promoter apFAB29 | Regulatory | BIOFAB | 48 | . . . aagtctaacctataggatacttacagccat | |
BBa_K2832137 | BIOFAB Modular Promoter apFAB77 | Regulatory | BIOFAB | 37 | . . . ttatcccttgcggcgacataattatttcat | |
BBa_K2832138 | BIOFAB Modular Promoter apFAB36 | Regulatory | BIOFAB | 47 | . . . ttaatcatccggctcgtataatagattcat | |
BBa_K2832139 | BIOFAB Modular Promoter apFAB44 | Regulatory | BIOFAB | 47 | . . . cgcatctttttgtaccatacttacagccat | |
BBa_K2832140 | BIOFAB Modular Promoter apFAB102 | Regulatory | BIOFAB | 48 | . . . ttatcccttgcggcgacataattatttcat | |
BBa_K2832141 | BIOFAB Modular Promoter apFAB37 | Regulatory | BIOFAB | 47 | . . . ttaatcatccggctcgcataattatttcat | |
BBa_K2832142 | BIOFAB Modular Promoter apFAB41 | Regulatory | BIOFAB | 47 | . . . caggaaaatttttctgtataatagattcat | |
BBa_K2832143 | BIOFAB Modular Promoter apFAB63 | Regulatory | BIOFAB | 37 | . . . ttaatcatccggctcgtagatttaacgtat | |
BBa_K2832144 | BIOFAB Modular Promoter apFAB140 | Regulatory | BIOFAB | 45 | . . . caggaaaatttttctgtataatgtgtggat | |
BBa_K2832145 | bIOFAB Modular Promoter apFAB64 | Regulatory | BIOFAB | 37 | . . . caggaaaatttttctgatacttacagccat | |
BBa_K2832146 | BIOFAB Modular Promoter apFAB40 | Regulatory | BIOFAB | 47 | . . . caggaaaatttttctgtataatgtgtggat | |
BBa_K2832147 | BIOFAB Modular Promoter apFAB97 | Regulatory | BIOFAB | 48 | . . . cgcatctttttgtacccataattatttcat | |
BBa_K2832148 | BIOFAB modular Promoter apFAB78 | Regulatory | BIOFAB | 37 | . . . ttatcccttgcggcgatagatttaacgtat | |
BBa_K2832149 | BIOFAB Modular Promoter apFAB69 | Regulatory | BIOFAB | 37 | . . . cgcatctttttgtaccatacttacagccat | |
BBa_K2832150 | BIOFAB Modular Promoter apFAB103 | Regulatory | BIOFAB | 48 | . . . ttatcccttgcggcgatagatttaacgtat | |
BBa_K2832151 | BIOFAB Modular Promoter apFAB73 | Regulatory | BIOFAB | 37 | . . . cgcatctttttgtacctagatttaacgtat | |
BBa_K2832152 | BIOFAB Modular Promoter apFAB66 | Regulatory | BIOFAB | 37 | . . . caggaaaatttttctgtataatagattcat | |
BBa_K2832153 | BIOFAB Modular Promoter apFAB126 | Regulatory | BIOFAB | 37 | . . . ttatcccttgcggcgatataatagattcat | |
BBa_K2832154 | BIOFAB Modular Promoter apFAB95 | Regulatory | BIOFAB | 48 | . . . cgcatctttttgtacctataatgtgtggat | |
BBa_K2832155 | BIOFAB Modular Promoter apFAB151 | Regulatory | BIOFAB | 45 | . . . ttatcccttgcggcgatataatagattcat | |
BBa_K2832156 | BIOFAB Modular Promoter apFAB48 | Regulatory | BIOFAB | 47 | . . . cgcatctttttgtacctagatttaacgtat | |
BBa_K2832157 | BIOFAB Modular Promoter apFAB82 | Regulatory | BIOFAB | 49 | 1 | . . . aagtctaacctataggcataattatttcat |
BBa_K2832158 | BIOFAB Modular Promoter apFAB141 | Regulatory | BIOFAB | 45 | . . . caggaaaatttttctgtataatagattcat | |
BBa_K2832159 | BIOFAB Modular Promoter apFAB150 | Regulatory | BIOFAB | 45 | . . . ttatcccttgcggcgatataatgtgtggat | |
BBa_K2832160 | BIOFAB Modular Promoter apFAB125 | Regulatory | BIOFAB | 37 | . . . ttatcccttgcggcgatataatgtgtggat | |
BBa_K2832161 | BIOFAB Modular Promoter apFAB33 | Regulatory | BIOFAB | 48 | . . . aagtctaacctataggtagatttaacgtat | |
BBa_K2832162 | BIOFAB Modular Promoter apFAB121 | Regulatory | BIOFAB | 37 | . . . cgcatctttttgtacctataatagattcat | |
BBa_K2832163 | BIOFAB modular Promoter apFAB111 | Regulatory | BIOFAB | 37 | . . . ttaatcatccggctcgtataatagattcat | |
BBa_K2832164 | BIOFAB modular Promoter apFAB58 | Regulatory | BIOFAB | 38 | . . . aagtctaacctataggtagatttaacgtat | |
BBa_K2832165 | BIOFAB modular Promoter apFAB94 | Regulatory | BIOFAB | 48 | . . . cgcatctttttgtaccatacttacagccat | |
BBa_K2832166 | BIOFAB modular Promoter apFAB145 | Regulatory | BIOFAB | 45 | . . . cgcatctttttgtacctataatgtgtggat | |
BBa_K2832167 | BIOFAB Modular Promoter apFAB118 | Regulatory | BIOFAB | 37 | . . . caggaaaatttttctgtagatttaacgtat | |
BBa_K2832168 | BIOFAB Modular Promoter apFAB106 | Regulatory | BIOFAB | 38 | . . . aagtctaacctataggtataatagattcat | |
BBa_K2832169 | BIOFAB Modular Promoter apFAB110 | Regulatory | BIOFAB | 37 | . . . ttaatcatccggctcgtataatgtgtggat | |
BBa_K2832170 | BIOFAB Modular Promoter apFAB105 | Regulatory | BIOFAB | 38 | . . . aagtctaacctataggtataatgtgtggat | |
BBa_K2832171 | BIOFAB Modular Promoter apFAB38 | Regulatory | BIOFAB | 47 | . . . ttaatcatccggctcgtagatttaacgtat | |
BBa_K2832172 | BIOFAB Modular Promoter apFAB89 | Regulatory | BIOFAB | 48 | . . . caggaaaatttttctgatacttacagccat | |
BBa_K2832173 | BIOFAB Modular Promoter apFAB142 | Regulatory | BIOFAB | 45 | . . . caggaaaatttttctgcataattatttcat | |
BBa_K2832174 | BIOFAB Modular Promoter apFAB130 | Regulatory | BIOFAB | 46 | . . . aagtctaacctataggtataatgtgtggat | |
BBa_K2832175 | BIOFAB Modular Promoter apFAB131 | Regulatory | BIOFAB | 46 | . . . aagtctaacctataggtataatagattcat | |
BBa_K2832176 | BIOFAB Modular Promoter apFAB143 | Regulatory | BIOFAB | 45 | . . . caggaaaatttttctgtagatttaacgtat | |
BBa_K2832177 | BIOFAB Modular Promoter apFAB87 | Regulatory | BIOFAB | 48 | . . . ttaatcatccggctcgcataattatttcat | |
BBa_K2832178 | BIOFAB Modular Promoter apFAB104 | Regulatory | BIOFAB | 38 | . . . aagtctaacctataggatacttacagccat | |
BBa_K2832179 | BIOFAB Modular Promoter apFAB98 | Regulatory | BIOFAB | 48 | . . . cgcatctttttgtacctagatttaacgtat | |
BBa_K2832180 | BIOFAB Modular Promoter apFAB51 | Regulatory | BIOFAB | 47 | . . . ttatcccttgcggcgatataatagattcat | |
BBa_K2832181 | BIOFAB Modular Promoter apFAB49 | Regulatory | BIOFAB | 47 | . . . ttatcccttgcggcgaatacttacagccat | |
BBa_K2832182 | BIOFAB Modular Promoter apFAB120 | Regulatory | BIOFAB | 37 | . . . cgcatctttttgtacctataatgtgtggat | |
BBa_K2832183 | BIOFAB Modular Promoter apFAB83 | Regulatory | BIOFAB | 49 | . . . aagtctaacctataggtagatttaacgtat | |
BBa_K2832184 | BIOFAB Modular Promoter apFAB117 | Regulatory | BIOFAB | 37 | . . . caggaaaatttttctgcataattatttcat | |
BBa_K2832185 | BIOFAB Modular Promoter apFAB129 | Regulatory | BIOFAB | 46 | . . . aagtctaacctataggatacttacagccat | |
BBa_K2832186 | BIOFAB Modular Promoter apFAB146 | Regulatory | BIOFAB | 45 | . . . cgcatctttttgtacctataatagattcat | |
BBa_K2832187 | BIOFAB Modular Promoter apFAB59 | Regulatory | BIOFAB | 37 | . . . ttaatcatccggctcgatacttacagccat | |
BBa_K2832188 | BIOFAB Modular Promoter apFAB127 | Regulatory | BIOFAB | 37 | . . . ttatcccttgcggcgacataattatttcat | |
BBa_K2832189 | BIOFAB Modular Promoter apFAB88 | Regulatory | BIOFAB | 48 | . . . ttaatcatccggctcgtagatttaacgtat | |
BBa_K2832190 | BIOFAB Modular Promoter apFAB86 | Regulatory | BIOFAB | 48 | . . . ttaatcatccggctcgtataatagattcat | |
BBa_K2832191 | BIOFAB Modular Promoter apFAB74 | Regulatory | BIOFAB | 37 | . . . ttatcccttgcggcgaatacttacagccat | |
BBa_K2832192 | BIOFAB Modular Promoter apFAB152 | Regulatory | BIOFAB | 45 | . . . ttatcccttgcggcgacataattatttcat | |
BBa_K2832193 | BIOFAB Modular Promoter apFAB122 | Regulatory | BIOFAB | 37 | . . . cgcatctttttgtacccataattatttcat | |
BBa_K2832194 | BIOFAB Modular Promoter apFAB128 | Regulatory | BIOFAB | 37 | . . . ttatcccttgcggcgatagatttaacgtat | |
BBa_K2832195 | BIOFAB Modular Promoter apFAB99 | Regulatory | BIOFAB | 48 | . . . ttatcccttgcggcgaatacttacagccat | |
BBa_K2832196 | BIOFAB Modular Promoter apFAB119 | Regulatory | BIOFAB | 37 | . . . cgcatctttttgtaccatacttacagccat | |
BBa_K2832197 | BIOFAB Modular Promoter apFAB112 | Regulatory | BIOFAB | 37 | . . . ttaatcatccggctcgcataattatttcat | |
BBa_K2832198 | BIOFAB Modular Promoter apFAB34 | Regulatory | BIOFAB | 47 | . . . ttaatcatccggctcgatacttacagccat | |
BBa_K2832199 | BIOFAB Modular Promoter apFAB147 | Regulatory | BIOFAB | 45 | . . . cgcatctttttgtacccataattatttcat | |
BBa_K2832200 | BIOFAB Modular Promoter apFAB144 | Regulatory | BIOFAB | 45 | . . . cgcatctttttgtaccatacttacagccat | |
BBa_K2832201 | BIOFAB Modular Promoter apFAB35 | Regulatory | BIOFAB | 47 | . . . ttaatcatccggctcgtataatgtgtggat | |
BBa_K2832202 | BIOFAB modular Promoter apFAB107 | Regulatory | BIOFAB | 38 | . . . aagtctaacctataggcataattatttcat | |
BBa_K2832203 | BIOFAB modular Promoter apFAB123 | Regulatory | BIOFAB | 37 | . . . cgcatctttttgtacctagatttaacgtat | |
BBa_K2832204 | BIOFAB Modular Promoter apFAB137 | Regulatory | BIOFAB | 45 | . . . ttaatcatccggctcgcataattatttcat | |
BBa_K2832205 | BIOFAB Modular Promoter apFAB113 | Regulatory | BIOFAB | 37 | . . . ttaatcatccggctcgtagatttaacgtat | |
BBa_K2832206 | BIOFAB Modular Promoter apFAB84 | Regulatory | BIOFAB | 48 | . . . ttaatcatccggctcgatacttacagccat | |
BBa_K2832207 | BIOFAB Modular Promoter apFAB148 | Regulatory | BIOFAB | 45 | . . . cgcatctttttgtacctagatttaacgtat | |
BBa_K2832208 | BIOFAB Modular Promoter apFAB108 | Regulatory | BIOFAB | 38 | . . . aagtctaacctataggtagatttaacgtat | |
BBa_K2832209 | BIOFAB Modular Promoter apFAB114 | Regulatory | BIOFAB | 37 | . . . caggaaaatttttctgatacttacagccat | |
BBa_K2832210 | BIOFAB Modular Promoter apFAB136 | Regulatory | BIOFAB | 45 | . . . ttaatcatccggctcgtataatagattcat | |
BBa_K2832211 | BIOFAB Modular Promoter apFAB124 | Regulatory | BIOFAB | 37 | . . . ttatcccttgcggcgaatacttacagccat | |
BBa_K2832212 | BIOFAB Modular Promoter apFAB149 | Regulatory | BIOFAB | 45 | . . . ttatcccttgcggcgaatacttacagccat | |
BBa_K2832213 | BIOFAB Modular Promoter apFAB134 | Regulatory | BIOFAB | 45 | . . . ttaatcatccggctcgatacttacagccat | |
BBa_K2832214 | BIOFAB Modular Promoter apFAB138 | Regulatory | BIOFAB | 45 | . . . ttaatcatccggctcgtagatttaacgtat | |
BBa_K2832215 | BIOFAB Modular Promoter apFAB43 | Regulatory | BIOFAB | 47 | . . . caggaaaatttttctgtagatttaacgtat | |
BBa_K2832216 | BIOFAB Modular Promoter apFAB133 | Regulatory | BIOFAB | 46 | . . . aagtctaacctataggtagatttaacgtat | |
BBa_K2832217 | BIOFAB Modular Promoter apFAB139 | Regulatory | BIOFAB | 45 | . . . caggaaaatttttctgatacttacagccat | |
BBa_K2832218 | BIOFAB Modular Promoter apFAB91 | Regulatory | BIOFAB | 48 | . . . caggaaaatttttctgtataatagattcat | |
BBa_K2832219 | BIOFAB Modular Promoter apFAB90 | Regulatory | BIOFAB | 48 | 1 | . . . caggaaaatttttctgtataatgtgtggat |
Randomized Promoters Table Generated by the Registry
Name | Description | Type | Created by | length | uses | seq |
---|---|---|---|---|---|---|
BBa_J97008 | BIOFAB Random Promoter apFAB342 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcataaaatttgtgga |
BBa_K3702000 | BIOFAB Random Promoter apFAB347 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcttaatatgtgtgga |
BBa_K3702001 | BIOFAB Random Promoter apFAB345 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcgtagagtatgtgga |
BBa_K3702002 | BIOFAB Random Promoter apFAB341 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcgtaatatgtgtgga |
BBa_K3702003 | BIOFAB Random Promoter apFAB317 | Regulatory | BIOFAB | 36 | -1 | . . . tttaatcatccggctcgtataatgtgtgga |
BBa_K3702004 | BIOFAB Random Promoter apFAB338 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcctaggatgtgtgga |
BBa_K3702005 | BIOFAB Random Promoter apFAB323 | Regulatory | BIOFAB | 36 | -1 | . . . tttaatcatccggctcgtataatgtgtgga |
BBa_K3702006 | BIOFAB Random Promoter apFAB339 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcgtaatttatgtgga |
BBa_K3702007 | BIOFAB Random Promoter apFAB321 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcgtaacttatgtgga |
BBa_K3702008 | BIOFAB Random Promoter apFAB340 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcgtagtatgtgtgga |
BBa_K3702009 | BIOFAB Random Promoter apFAB322 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcgtataatgtgtgga |
BBa_K3702010 | BIOFAB Random Promoter apFAB346 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcgtaatgtttgtgga |
BBa_K3702011 | BIOFAB Random Promoter apFAB303 | Regulatory | BIOFAB | 35 | -1 | . . . tcttaatcatcggctcgtataatgtgtgga |
BBa_K3702012 | BIOFAB Random Promoter apFAB302 | Regulatory | BIOFAB | 36 | -1 | . . . tttaatcatccggctcgtataatgtgtgga |
BBa_K3702013 | BIOFAB Random Promoter apFAB297 | Regulatory | BIOFAB | 36 | -1 | . . . tttaatcatccggctcgtataatgtgtgga |
BBa_K3702014 | BIOFAB Random Promoter apFAB301 | Regulatory | BIOFAB | 36 | -1 | . . . tttaatcatccggctcgtataatgtgtgga |
BBa_K3702015 | BIOFAB Random Promoter apFAB298 | Regulatory | BIOFAB | 36 | -1 | . . . cttaatcatccggctcgtataatgtgtgga |
BBa_K3702016 | BIOFAB Random Promoter apFAB306 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcgtagtgtttgtgga |
BBa_K3702017 | BIOFAB Random Promoter apFAB307 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcatatcgtttgtgga |
BBa_K3702018 | BIOFAB Random Promoter apFAB296 | Regulatory | BIOFAB | 36 | -1 | . . . tttaatcatccggctcgtataatgtgtgga |
BBa_K3702019 | BIOFAB Random Promoter apFAB308 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcgtaggttatgtgga |
BBa_K3702020 | BIOFAB Random Promoter apFAB295 | Regulatory | BIOFAB | 35 | -1 | . . . tcttaatcatcggctcgtataatgtgtgga |
BBa_K3702021 | BIOFAB Random Promoter apFAB300 | Regulatory | BIOFAB | 36 | -1 | . . . cttaatcatccggctcgtataatgtgtgga |
BBa_K3702022 | BIOFAB Random Promoter apFAB299 | Regulatory | BIOFAB | 36 | -1 | . . . tttaatcatccggctcgtataatgtgtgga |
BBa_K3702023 | BIOFAB Random Promoter apFAB309 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcgtagtgtctgtgga |
BBa_K3702024 | BIOFAB Random Promoter apFAB305 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcgtagggtttgtgga |
BBa_K3702025 | BIOFAB Random Promoter apFAB313 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcttagggtgtgtgga |
BBa_K3702026 | BIOFAB Random Promoter apFAB310 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcctatcttctgtgga |
BBa_K3702027 | BIOFAB Random Promoter apFAB311 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcgtaggttgtgtgga |
BBa_K3702028 | BIOFAB Random Promoter apFAB279 | Regulatory | BIOFAB | 35 | -1 | . . . ctttaatcatcggctcgtataatgtgtgga |
BBa_K3702029 | BIOFAB Random Promoter apFAB314 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcctaagttgtgtgga |
BBa_K3702030 | BIOFAB Random Promoter apFAB281 | Regulatory | BIOFAB | 36 | -1 | . . . tttaatcatccggctcgtataatgtgtgga |
BBa_K3702031 | BIOFAB Random Promoter apFAB276 | Regulatory | BIOFAB | 35 | -1 | . . . tattaatcatcggctcgtataatgtgtgga |
BBa_K3702032 | BIOFAB Random Promoter apFAB312 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcttagtgtttgtgga |
BBa_K3702033 | BIOFAB Random Promoter apFAB273 | Regulatory | BIOFAB | 36 | -1 | . . . tttaatcatccggctcgtataatgtgtgga |
BBa_K3702034 | BIOFAB Random Promoter apFAB316 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcatatagtatgtgga |
BBa_K3702035 | BIOFAB Random Promoter apFAB282 | Regulatory | BIOFAB | 36 | -1 | . . . cttaatcatccggctcgtataatgtgtgga |
BBa_K3702036 | BIOFAB Random Promoter apFAB260 | Regulatory | BIOFAB | 35 | -1 | . . . tgttaatcatcggctcgtataatgtgtgga |
BBa_K3702037 | BIOFAB Random Promoter apFAB293 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcttaggttgtgtgga |
BBa_K3702038 | BIOFAB Random Promoter apFAB259 | Regulatory | BIOFAB | 36 | -1 | . . . cttaatcatccggctcgtataatgtgtgga |
BBa_K3702039 | BIOFAB Random Promoter apFAB284 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcataagttttgtgga |
BBa_K3702040 | BIOFAB Random Promoter apFAB285 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcctagcctctgtgga |
BBa_K3702041 | BIOFAB Random Promoter apFAB286 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcttagtttttgtgga |
BBa_K3702042 | BIOFAB Random Promoter apFAB257 | Regulatory | BIOFAB | 36 | -1 | . . . gttaatcatccggctcgtataatgtgtgga |
BBa_K3702043 | BIOFAB Random Promoter apFAB267 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcgtagggtctgtgga |
BBa_K3702044 | BIOFAB Random Promoter apFAB263 | Regulatory | BIOFAB | 36 | -1 | . . . gttaatcatccggctcgtataatgtgtgga |
BBa_K3702045 | BIOFAB Random Promoter apFAB262 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcgtataatgtgtgga |
BBa_K3702046 | BIOFAB Random Promoter apFAB265 | Regulatory | BIOFAB | 35 | -1 | . . . tattaatcatcggctcatccattatgtgga |
BBa_K3702047 | BIOFAB Random Promoter apFAB271 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcttagcgtgtgtgga |
BBa_K3702048 | BIOFAB Random Promoter apFAB278 | Regulatory | BIOFAB | 36 | -1 | . . . gttaatcatccggctcgtataatgtgtgga |
BBa_K3702049 | BIOFAB Random Promoter apFAB241 | Regulatory | BIOFAB | 35 | -1 | . . . attaatcatccggctcgtataatgtgtgga |
BBa_K3702050 | BIOFAB Random Promoter apFAB280 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcgtataatgtgtgga |
BBa_K3702051 | BIOFAB Random Promoter apFAB254 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcgtataatgtgtgga |
BBa_K3702052 | BIOFAB Random Promoter apFAB266 | Regulatory | BIOFAB | 35 | -1 | . . . aattaatcatcggctcttaggctatgtgga |
BBa_K3702053 | BIOFAB Random Promoter apFAB270 | Regulatory | BIOFAB | 35 | -1 | . . . aattaatcatcggctcataaagtgtgtgga |
BBa_K3702054 | BIOFAB Random Promoter apFAB287 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcctagggtttgtgga |
BBa_K3702055 | BIOFAB Random Promoter apFAB256 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcgtataatgtgtgga |
BBa_K3702056 | BIOFAB Random Promoter apFAB253 | Regulatory | BIOFAB | 36 | -1 | . . . gttaatcatccggctcgtataatgtgtgga |
BBa_K3702057 | BIOFAB Random Promoter apFAB264 | Regulatory | BIOFAB | 35 | -1 | . . . ctttaatcatcggctcgtataatgtgtgga |
BBa_K3702058 | BIOFAB Random Promoter apFAB337 | Regulatory | BIOFAB | 36 | -1 | . . . cttaatcatccggctcgtataatgtgtgga |
BBa_K3702059 | BIOFAB Random Promoter apFAB261 | Regulatory | BIOFAB | 36 | -1 | . . . cttaatcatccggctcgtataatgtgtgga |
BBa_K3702060 | BIOFAB Random Promoter apFAB272 | Regulatory | BIOFAB | 35 | -1 | . . . aattaatcatcggctcgtagagtttgtgga |
BBa_K3702061 | BIOFAB Random Promoter apFAB274 | Regulatory | BIOFAB | 36 | -1 | . . . tttaatcatccggctcgtataatgtgtgga |
BBa_K3702062 | BIOFAB Random Promoter apFAB258 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcctagtttctgtgga |
BBa_K3702063 | BIOFAB Random Promoter apFAB255 | Regulatory | BIOFAB | 35 | -1 | . . . aattaatcatcggctcgtataatgtgtgga |
BBa_K3702064 | BIOFAB Random Promoter apFAB268 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcatagcgtgtgtgga |
BBa_K3702065 | BIOFAB Random Promoter apFAB333 | Regulatory | BIOFAB | 36 | -1 | . . . cttaatcatccggctcgtataatgtgtgga |
BBa_K3702066 | BIOFAB Random Promoter apFAB326 | Regulatory | BIOFAB | 36 | -1 | . . . cttaatcatccggctcgtataatgtgtgga |
BBa_K3702067 | BIOFAB Random Promoter apFAB343 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcatagcgtctgtgga |
BBa_K3702068 | BIOFAB Random Promoter apFAB329 | Regulatory | BIOFAB | 36 | -1 | . . . cttaatcatccggctcgtatcatatgtgga |
BBa_K3702069 | BIOFAB Random Promoter apFAB332 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcgtataatgtgtgga |
BBa_K3702070 | BIOFAB Random Promoter apFAB252 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcatatgctttgtgga |
BBa_K3702071 | BIOFAB Random Promoter apFAB251 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcttaggttctgtgga |
BBa_K3702072 | BIOFAB Random Promoter apFAB226 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcgtataatctgtgga |
BBa_K3702073 | BIOFAB Random Promoter apFAB315 | Regulatory | BIOFAB | 36 | -1 | . . . cttaatcatccggctcgtataatgtgtgga |
BBa_K3702074 | BIOFAB Random Promoter apFAB335 | Regulatory | BIOFAB | 36 | -1 | . . . cttaatcatccggctcgtataatgtgtgga |
BBa_K3702075 | BIOFAB Random Promoter apFAB334 | Regulatory | BIOFAB | 36 | -1 | . . . gttaatcatccggctcgtataatgtgtgga |
BBa_K3702076 | BIOFAB Random Promoter apFAB319 | Regulatory | BIOFAB | 36 | -1 | . . . cttaatcatccggctcgtataatgtgtgga |
BBa_K3702077 | BIOFAB Random Promoter apFAB229 | Regulatory | BIOFAB | 36 | -1 | . . . tttaatcatccggctcgtataatgtgtgga |
BBa_K3702078 | BIOFAB Random Promoter apFAB228 | Regulatory | BIOFAB | 36 | -1 | . . . tttaatcatccggctcgtataatgtgtgga |
BBa_K3702079 | BIOFAB Random Promoter apFAB225 | Regulatory | BIOFAB | 36 | -1 | . . . gttaatcatccggctcctataatttgtgga |
BBa_K3702080 | BIOFAB Random Promoter apFAB224 | Regulatory | BIOFAB | 36 | -1 | . . . tttaatcatccggctcgtagagtgtgtgga |
BBa_K3702081 | BIOFAB Random Promoter apFAB324 | Regulatory | BIOFAB | 35 | -1 | . . . aattaatcatcggctcttaggctttgtgga |
BBa_K3702082 | BIOFAB Random Promoter apFAB230 | Regulatory | BIOFAB | 36 | -1 | . . . cttaatcatccggctcgtataatgtgtgga |
BBa_K3702083 | BIOFAB Random Promoter apFAB318 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcgtataatgtgtgga |
BBa_K3702084 | BIOFAB Random Promoter apFAB331 | Regulatory | BIOFAB | 36 | -1 | . . . cttaatcatccggctcggagactttgtgga |
BBa_K3702085 | BIOFAB Random Promoter apFAB304 | Regulatory | BIOFAB | 36 | -1 | . . . gttaatcatccggctcgtataatgtgtgga |
BBa_K3702086 | BIOFAB Random Promoter apFAB231 | Regulatory | BIOFAB | 36 | -1 | . . . tttaatcatccggctcgtataatgtgtgga |
BBa_K3702087 | BIOFAB Random Promoter apFAB227 | Regulatory | BIOFAB | 36 | -1 | . . . cttaatcatccggctcgtataatgtgtgga |
BBa_K3702088 | BIOFAB Random Promoter apFAB209 | Regulatory | BIOFAB | 36 | -1 | . . . gttaatcatccggctcgtataatgtgtgga |
BBa_K3702089 | BIOFAB Random Promoter apFAB202 | Regulatory | BIOFAB | 36 | -1 | . . . gttaatcatccggctcgtataatctgtgga |
BBa_K3702090 | BIOFAB Random Promoter apFAB212 | Regulatory | BIOFAB | 35 | -1 | . . . ttttaatcatcggctcgtataatgtgtgga |
BBa_K3702091 | BIOFAB Random Promoter apFAB211 | Regulatory | BIOFAB | 36 | -1 | . . . gttaatcatccggctcgtataatgtgtgga |
BBa_K3702092 | BIOFAB Random Promoter apFAB221 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcatagactgtgtgga |
BBa_K3702093 | BIOFAB Random Promoter apFAB205 | Regulatory | BIOFAB | 36 | -1 | . . . cttaatcatccggctcgtattatatgtgga |
BBa_K3702094 | BIOFAB Random Promoter apFAB201 | Regulatory | BIOFAB | 36 | -1 | . . . cttaatcatccggctcctatagtgtgtgga |
BBa_K3702095 | BIOFAB Random Promoter apFAB193 | Regulatory | BIOFAB | 36 | -1 | . . . cttaatcatccggctcgtataatgtgtgga |
BBa_K3702096 | BIOFAB Random Promoter apFAB203 | Regulatory | BIOFAB | 36 | -1 | . . . gttaatcatccggctcgtagtctgtgtgga |
BBa_K3702097 | BIOFAB Random Promoter apFAB200 | Regulatory | BIOFAB | 35 | -1 | . . . aattaatcatcggctcttagggtttgtgga |
BBa_K3702098 | BIOFAB Random Promoter apFAB207 | Regulatory | BIOFAB | 36 | -1 | . . . tttaatcatccggctcatatactttgtgga |
BBa_K3702099 | BIOFAB Random Promoter apFAB206 | Regulatory | BIOFAB | 36 | -1 | . . . tttaatcatccggctcgtaccctttgtgga |
BBa_K3702101 | BIOFAB Random Promoter apFAB208 | Regulatory | BIOFAB | 36 | -1 | . . . gttaatcatccggctcgtataatgtgtgga |
BBa_K3702102 | BIOFAB Random Promoter apFAB181 | Regulatory | BIOFAB | 36 | -1 | . . . gttaatcatccggctcgtaaactgtgtgga |
BBa_K3702103 | BIOFAB Random Promoter apFAB204 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcctagtgtatgtgga |
BBa_K3702104 | BIOFAB Random Promoter apFAB190 | Regulatory | BIOFAB | 35 | -1 | . . . cgttaatcatcggctcgtataatgtgtgga |
BBa_K3702105 | BIOFAB Random Promoter apFAB189 | Regulatory | BIOFAB | 35 | -1 | . . . ccttaatcatcggctcgtataatgtgtgga |
BBa_K3702106 | BIOFAB Random Promoter apFAB184 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcgtacgatgtgtgga |
BBa_K3702107 | BIOFAB Random Promoter apFAB215 | Regulatory | BIOFAB | 35 | -1 | . . . ggttaatcatcggctcgtataatgtgtgga |
BBa_K3702108 | BIOFAB Random Promoter apFAB168 | Regulatory | BIOFAB | 35 | -1 | . . . cctaatcatccggctcgtataatgtgtgga |
BBa_K3702109 | BIOFAB Random Promoter apFAB197 | Regulatory | BIOFAB | 35 | -1 | . . . aattaatcatcggctcttaggttttgtgga |
BBa_K3702110 | BIOFAB Random Promoter apFAB199 | Regulatory | BIOFAB | 35 | -1 | . . . attaatcatccggctcgtagtgtgtgtgga |
BBa_K3702111 | BIOFAB Random Promoter apFAB216 | Regulatory | BIOFAB | 36 | -1 | . . . gttaatcatccggctcgtataatgtgtgga |
BBa_K3702112 | BIOFAB Random Promoter apFAB180 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcgtattgtatgtgga |
BBa_K3702113 | BIOFAB Random Promoter apFAB187 | Regulatory | BIOFAB | 36 | -1 | . . . gttaatcatccggctcgtatagtctgtgga |
BBa_K3702114 | BIOFAB Random Promoter apFAB182 | Regulatory | BIOFAB | 36 | -1 | . . . tttaatcatccggctcttaacttgtgtgga |
BBa_K3702115 | BIOFAB Random Promoter apFAB186 | Regulatory | BIOFAB | 36 | -1 | . . . gttaatcatccggctcgtatgttctgtgga |
BBa_K3702116 | BIOFAB Random Promoter apFAB183 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcctaggttatgtgga |
BBa_K3702117 | BIOFAB Random Promoter apFAB195 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcggaaagaatgtgga |
BBa_K3702118 | BIOFAB Random Promoter apFAB167 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcataaaatttgtgga |
BBa_K3702119 | BIOFAB Random Promoter apFAB177 | Regulatory | BIOFAB | 36 | -1 | . . . cttaatcatccggctcaggtgtaatgtgga |
BBa_K3702120 | BIOFAB Random Promoter apFAB192 | Regulatory | BIOFAB | 36 | -1 | . . . cttaatcatccggctcgtataatgtgtgga |
BBa_K3702121 | BIOFAB Random Promoter apFAB220 | Regulatory | BIOFAB | 35 | -1 | . . . aattaatcatcggctcatatggtctgtgga |
BBa_K3702122 | BIOFAB Random Promoter apFAB161 | Regulatory | BIOFAB | 36 | -1 | . . . cttaatcatccggctcttagagtatgtgga |
BBa_K3702123 | BIOFAB Random Promoter apFAB160 | Regulatory | BIOFAB | 36 | -1 | . . . cttaatcatccggctcttatagtttgtgga |
BBa_K3702124 | BIOFAB Random Promoter apFAB162 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcgtagtctgtgtgga |
BBa_K3702125 | BIOFAB Random Promoter apFAB159 | Regulatory | BIOFAB | 36 | -1 | . . . gttaatcatccggctcctagcatgtgtgga |
BBa_K3702126 | BIOFAB Random Promoter apFAB164 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcttaccgtttgtgga |
BBa_K3702127 | BIOFAB Random Promoter apFAB166 | Regulatory | BIOFAB | 36 | -1 | . . . cttaatcatctggctcatagtttatgtgga |
BBa_K3702128 | BIOFAB Random Promoter apFAB157 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcatattttttgtgga |
BBa_K3702129 | BIOFAB Random Promoter apFAB217 | Regulatory | BIOFAB | 35 | -1 | . . . aattaatcatcggctcctagggtttgtgga |
BBa_K3702130 | BIOFAB Random Promoter apFAB156 | Regulatory | BIOFAB | 36 | -1 | . . . gttaatcatccggctcctagtttgtgtgga |
BBa_K3702131 | BIOFAB Random Promoter apFAB213 | Regulatory | BIOFAB | 36 | -1 | . . . gttaatcatccggctcgtataatgtgtgga |
BBa_K3702132 | BIOFAB Random Promoter apFAB325 | Regulatory | BIOFAB | 35 | -1 | . . . aattaatatccggctcgtagcgtctgtgga |
BBa_K3702133 | BIOFAB Random Promoter apFAB188 | Regulatory | BIOFAB | 35 | -1 | . . . ccttaatcatcggctcgtataatgtgtgga |
BBa_K3702134 | BIOFAB Random Promoter apFAB210 | Regulatory | BIOFAB | 35 | -1 | . . . cgttaatcatcggctcgtataatgtgtgga |
BBa_K3702135 | BIOFAB Random Promoter apFAB327 | Regulatory | BIOFAB | 36 | -1 | . . . tttaatcatccggctcctactctgtgtgga |
BBa_K3702136 | BIOFAB Random Promoter apFAB294 | Regulatory | BIOFAB | 36 | -1 | . . . gttaatcatccggctcataaaatttgtgga |
Terminators Table Generated by the Registry
Name | Description | Type | Created by | length | uses | seq |
---|---|---|---|---|---|---|
BBa_K3702161 | BIOFAB Terminator apFAB376 | Terminator | BIOFAB | 34 | -1 | . . . aaaaaccccgcttcggcggggttttttcgc |
BBa_K3702173 | BIOFAB Terminator apFAB388 | Terminator | BIOFAB | 39 | -1 | . . . ccccgcccctgacagggcggggtttttttt |
BBa_K3702137 | BIOFAB Terminator apFAB352 | Terminator | BIOFAB | 86 | -1 | . . . gggggagagggaagtcatgaaaaaactaac |
BBa_K3702138 | BIOFAB Terminator apFAB353 | Terminator | BIOFAB | 50 | -1 | . . . atatttcgattgcatgtgcaattttttgca |
BBa_K3702139 | BIOFAB Terminator apFAB354 | Terminator | BIOFAB | 33 | -1 | . . . tcgcaaaaaaccccgctggggttttttcgc |
BBa_K3702140 | BIOFAB Terminator apFAB355 | Terminator | BIOFAB | 80 | -1 | . . . tgtctattatccctaagcccattttttgca |
BBa_K3702141 | BIOFAB Terminator apFAB356 | Terminator | BIOFAB | 121 | -1 | . . . tgcactaagcacataattgctcacagccaa |
BBa_K3702142 | BIOFAB Terminator apFAB357 | Terminator | BIOFAB | 52 | -1 | . . . gatacccagcccgcctaatcaatgcaaaca |
BBa_K3702143 | BIOFAB Terminator apFAB358 | Terminator | BIOFAB | 31 | -1 | . . . gcaaaaaaccccgctgcggggttttttcgc |
BBa_K3702144 | BIOFAB Terminator apFAB359 | Terminator | BIOFAB | 83 | -1 | . . . gggggagagggaagtcatgaaaaaactaac |
BBa_K3702145 | BIOFAB Terminator apFAB360 | Terminator | BIOFAB | 40 | -1 | . . . tgtctattatccctaagcccattttttgca |
BBa_K3702146 | BIOFAB Terminator apFAB361 | Terminator | BIOFAB | 105 | -1 | . . . cagccgtatgacaaggtcggcatcaggtgt |
BBa_K3702147 | BIOFAB Terminator apFAB362 | Terminator | BIOFAB | 80 | -1 | . . . cagccgcctgtcgcccgaaggccggtcggc |
BBa_K3702148 | BIOFAB Terminator apFAB363 | Terminator | BIOFAB | 91 | -1 | . . . gcgcggttgataacggttcagacaggttta |
BBa_K3702149 | BIOFAB Terminator apFAB364 | Terminator | BIOFAB | 102 | -1 | . . . cgataaagaagatttagcttcaaataaaac |
BBa_K3702150 | BIOFAB Terminator apFAB365 | Terminator | BIOFAB | 108 | -1 | . . . cagccgtatgacaaggtcggcatcaggtgt |
BBa_K3702151 | BIOFAB Terminator apFAB366 | Terminator | BIOFAB | 109 | -1 | . . . cagccgtatgacaaggtcggcatcaggtgt |
BBa_K3702152 | BIOFAB Terminator apFAB367 | Terminator | BIOFAB | 83 | -1 | . . . gaacaaaattagagaataacaatgcaaaca |
BBa_K3702153 | BIOFAB Terminator apFAB368 | Terminator | BIOFAB | 96 | -1 | . . . gcgcggttgataacggttcagacaggttta |
BBa_K3702154 | BIOFAB Terminator apFAB369 | Terminator | BIOFAB | 106 | -1 | . . . cagccgtatgacaaggtcggcatcaggtgt |
BBa_K3702155 | BIOFAB Terminator apFAB370 | Terminator | BIOFAB | 97 | -1 | . . . gcgcggttgataacggttcagacaggttta |
BBa_K3702156 | BIOFAB Terminator apFAB371 | Terminator | BIOFAB | 93 | -1 | . . . cccccgatgtggcgcagactgatttatcac |
BBa_K3702157 | BIOFAB Terminator apFAB372 | Terminator | BIOFAB | 91 | -1 | . . . gggggagagggaagtcatgaaaaaactaac |
BBa_K3702158 | BIOFAB Terminator apFAB373 | Terminator | BIOFAB | 84 | -1 | . . . attactcaacaggtaaggcgcgaggttttc |
BBa_K3702159 | BIOFAB Terminator apFAB374 | Terminator | BIOFAB | 104 | -1 | . . . ttgggtcagtcgtataaaggtcattacgga |
BBa_K3702160 | BIOFAB Terminator apFAB375 | Terminator | BIOFAB | 80 | -1 | . . . tcccgatcttaatgaatggccggaagtggt |
BBa_K3702162 | BIOFAB Terminator apFAB377 | Terminator | BIOFAB | 91 | -1 | . . . gggggagagggaagtcatgaaaaaactaac |
BBa_K3702163 | BIOFAB Terminator apFAB378 | Terminator | BIOFAB | 91 | -1 | . . . caagcagcagattacgcgcagaaaaaaagg |
BBa_K3702164 | BIOFAB Terminator apFAB379 | Terminator | BIOFAB | 85 | -1 | . . . gaacaaaattagagaataacaatgcaaaca |
BBa_K3702165 | BIOFAB Terminator apFAB380 | Terminator | BIOFAB | 85 | -1 | . . . gaacaaaattagagaataacaatgcaaaca |
BBa_K3702166 | BIOFAB Terminator apFAB381 | Terminator | BIOFAB | 90 | -1 | . . . ttccgggcattaaccctcactaacaggaga |
BBa_K3702167 | BIOFAB Terminator apFAB382 | Terminator | BIOFAB | 87 | -1 | . . . gaacaaaattagagaataacaatgcaaaca |
BBa_K3702168 | BIOFAB Terminator apFAB383 | Terminator | BIOFAB | 88 | -1 | . . . tttataaggagacactttatgtttaagaag |
BBa_K3702169 | BIOFAB Terminator apFAB384 | Terminator | BIOFAB | 91 | -1 | . . . atctgttgtttgtcggtgaacgctctcctg |
BBa_K3702170 | BIOFAB Terminator apFAB385 | Terminator | BIOFAB | 87 | -1 | . . . gaacaaaattagagaataacaatgcaaaca |
BBa_K3702171 | BIOFAB Terminator apFAB386 | Terminator | BIOFAB | 85 | -1 | . . . ggagattttcaacatgaaaaaattattatt |
BBa_K3702172 | BIOFAB Terminator apFAB387 | Terminator | BIOFAB | 91 | -1 | . . . atctgttgtttgtcggtgaacgctctcctg |
BBa_K3702174 | BIOFAB Terminator apFAB389 | Terminator | BIOFAB | 91 | -1 | . . . atctgttgtttgtcggtgaacactctcccg |
BBa_K3702175 | BIOFAB Terminator apFAB390 | Terminator | BIOFAB | 89 | -1 | . . . gaccttaaaaacataaccgaggagcagaca |
BBa_K3702176 | BIOFAB Terminator apFAB391 | Terminator | BIOFAB | 82 | -1 | . . . tttggaggggcagaaagatgaatgactgtc |