Difference between revisions of "Help:Protocols/Linearized Plasmid Backbones"

(Primers)
m
 
(12 intermediate revisions by 3 users not shown)
Line 3: Line 3:
 
{{TOCright}}
 
{{TOCright}}
  
iGEM HQ provides linearized plasmid backbones for use during 3A Assembly and for shipping parts (pSB1C3). The following are the recommended protocols for using the linearized backbones and making your own.
+
The following are the recommended protocols for using the linearized backbones and making your own.
  
If you're having issues or questions regarding linearized plasmid backbones contact us at '''hq (at) igem . org'''. We can also send more by request. Alternatively, you can find all of our standard plasmid backbones (pSB1C3, pSB1K3, etc) paired with <partinfo>BBa_J04450</partinfo> in the Distribution Kit.
+
If you're having issues or questions regarding linearized plasmid backbones contact us at '''hq (at) igem . org'''. You can find all of our standard plasmid backbones (pSB1C3, pSB1K3, etc) paired with <partinfo>BBa_J04450</partinfo> in the Distribution Kit.
  
 
''This protocol was developed by Tom Knight. Samples of standard Registry plasmid backbones prepared using this method are sent out in the DNA Distribution kits.''
 
''This protocol was developed by Tom Knight. Samples of standard Registry plasmid backbones prepared using this method are sent out in the DNA Distribution kits.''
Line 14: Line 14:
  
 
=Using the Linearized Plasmid Backbones=
 
=Using the Linearized Plasmid Backbones=
The DNA Distribution should come with a set of linearized plasmid backbones: pSB1A3, pSB1C3, pSB1K3.m1, and pSB1T3. The linearized plasmid backbones (25ng/ul at 50ul) should be stored at 4C or lower. Prior to ligation the plasmid backbones need to be cut with EcoRI and PstI.
+
Linearized plasmid backbones that iGEM has produced are adjusted to 25ng/ul at 50ul and should be stored at -20C or lower. Prior to ligation the plasmid backbones need to be cut with EcoRI and PstI.
  
 
==Digest==
 
==Digest==
Line 20: Line 20:
 
** 5 ul NEB Buffer 2
 
** 5 ul NEB Buffer 2
 
** 0.5 ul BSA
 
** 0.5 ul BSA
** 0.5 ul [http://www.neb.com/nebecomm/products/productR3101.asp EcoRI-HF]
+
** 0.5 ul [http://www.neb.com/nebecomm/products/productR3101 EcoRI-HF]
 
** 0.5 ul [http://www.neb.com/nebecomm/products/productR0140.asp PstI]
 
** 0.5 ul [http://www.neb.com/nebecomm/products/productR0140.asp PstI]
 
** 0.5 ul [http://www.neb.com/nebecomm/products/productR0176.asp DpnI] (Used to digest any template DNA from production)
 
** 0.5 ul [http://www.neb.com/nebecomm/products/productR0176.asp DpnI] (Used to digest any template DNA from production)
Line 32: Line 32:
 
==Ligation==
 
==Ligation==
 
* Add 2ul of digested plasmid backbone (25 ng)
 
* Add 2ul of digested plasmid backbone (25 ng)
* Add equimolar amount of EcoRI-HF SpeI digested fragment (< 3 ul)
+
* Add equimolar amount of EcoRI-HF PstI digested fragment (< 3 ul)
* Add equimolar amount of XbaI PstI digested fragment (< 3 ul)
+
 
* Add 1 ul [http://www.neb.com/nebecomm/products/productm0202.asp T4 DNA ligase buffer]. '''Note:''' Do not use quick ligase
 
* Add 1 ul [http://www.neb.com/nebecomm/products/productm0202.asp T4 DNA ligase buffer]. '''Note:''' Do not use quick ligase
* Add 0.5 ul [http://www.neb.com/nebecomm/products/productm0202.asp T4 DNA ligase]
+
* Add 0.5 ul [https://www.neb.com/products/m0202-t4-dna-ligase.asp T4 DNA ligase]
 
* Add water to 10 ul
 
* Add water to 10 ul
 
* Ligate 16C/30 min, heat kill 80C/20 min
 
* Ligate 16C/30 min, heat kill 80C/20 min
Line 42: Line 41:
 
'''Note:''' For linearized plasmid backbones provided by iGEM HQ, a plasmid backbone with an insert of [[Part:BBa_J04450  | BBa_J04450]] was used as template. As a result any red colonies that appear during your ligation may be due to the template as a background. Digesting with Dpn1 before use should reduce this occurrence.
 
'''Note:''' For linearized plasmid backbones provided by iGEM HQ, a plasmid backbone with an insert of [[Part:BBa_J04450  | BBa_J04450]] was used as template. As a result any red colonies that appear during your ligation may be due to the template as a background. Digesting with Dpn1 before use should reduce this occurrence.
  
=Making Linearized Plasmid Backbones=
 
==Bulk Production==
 
The following is the protocol that we used to create the linearized plasmid backbones shipped with the Spring 2011 DNA Distribution. The protocol is in 96 well format, but may be scaled down to suit smaller batches.
 
  
[[Help:Production/2012 Plasmid Backbones| 2012 Plasmid Backbone Production]]
+
=How to Make Linearized Plasmid Backbones=
 +
==Bulk Production==
 +
The following is the protocol that we have used to create the linearized plasmid backbones in the iGEM lab. The protocol is in 96 well format, but may be scaled down to suit smaller batches.
  
[[2011 Plasmid Backbone Production]]
 
  
 
===PCR mix===
 
===PCR mix===
Line 60: Line 57:
  
 
====Bulk Reaction====
 
====Bulk Reaction====
* 9.6ml of [http://products.invitrogen.com/ivgn/product/10790020?ICID=search-10790020 PCR Supermix High Fidelity]
+
* 9.6ml of [https://www.thermofisher.com/order/catalog/product/12532016 PCR Supermix High Fidelity]
 
* 67 ul of primer SB-prep-2Eb
 
* 67 ul of primer SB-prep-2Eb
 
* 67 ul of primer SB-prep-3P-1
 
* 67 ul of primer SB-prep-3P-1

Latest revision as of 18:07, 23 June 2021

The following are the recommended protocols for using the linearized backbones and making your own.

If you're having issues or questions regarding linearized plasmid backbones contact us at hq (at) igem . org. You can find all of our standard plasmid backbones (pSB1C3, pSB1K3, etc) paired with BBa_J04450 in the Distribution Kit.

This protocol was developed by Tom Knight. Samples of standard Registry plasmid backbones prepared using this method are sent out in the DNA Distribution kits.

Why Linearized Plasmid Backbones?

Short single stranded DNA fragments will not ligate to 4 bp overhangs. By creating a very short overhang on a PCR of a plasmid backbone, the remnant, when cut with EcoRI and PstI is sufficiently short that it will not anneal at ligation temperature, and will therefore not ligate. This allows us to build high quality construction plasmid backbone without purifying away the cut fragments remaining after PCR.


Using the Linearized Plasmid Backbones

Linearized plasmid backbones that iGEM has produced are adjusted to 25ng/ul at 50ul and should be stored at -20C or lower. Prior to ligation the plasmid backbones need to be cut with EcoRI and PstI.

Digest

  • Enzyme Master Mix for Plasmid Backbone (25ul total, for 5 rxns)
    • 5 ul NEB Buffer 2
    • 0.5 ul BSA
    • 0.5 ul [http://www.neb.com/nebecomm/products/productR3101 EcoRI-HF]
    • 0.5 ul [http://www.neb.com/nebecomm/products/productR0140.asp PstI]
    • 0.5 ul [http://www.neb.com/nebecomm/products/productR0176.asp DpnI] (Used to digest any template DNA from production)
    • 18 ul dH20
  • Digest Plasmid Backbone
    • Add 4 ul linearized plasmid backbone (25ng/ul for 100ng total)
    • Add 4 ul of Enzyme Master Mix
    • Digest 37C/30 min, heat kill 80C/20 min

Ligation

  • Add 2ul of digested plasmid backbone (25 ng)
  • Add equimolar amount of EcoRI-HF PstI digested fragment (< 3 ul)
  • Add 1 ul [http://www.neb.com/nebecomm/products/productm0202.asp T4 DNA ligase buffer]. Note: Do not use quick ligase
  • Add 0.5 ul T4 DNA ligase
  • Add water to 10 ul
  • Ligate 16C/30 min, heat kill 80C/20 min
  • Transform with 1-2 ul of product

Note: For linearized plasmid backbones provided by iGEM HQ, a plasmid backbone with an insert of BBa_J04450 was used as template. As a result any red colonies that appear during your ligation may be due to the template as a background. Digesting with Dpn1 before use should reduce this occurrence.


How to Make Linearized Plasmid Backbones

Bulk Production

The following is the protocol that we have used to create the linearized plasmid backbones in the iGEM lab. The protocol is in 96 well format, but may be scaled down to suit smaller batches.


PCR mix

Primers

gccgctgcagtccggcaaaaaa,SB-prep-3P-1
atgaattccagaaatcatccttagcg,SB-prep-2Ea

Diluted to 30 pmol/ul

These primers have been tested with pSB1C3, pSB1A3, pSB1K3, and pSB1T3..

Bulk Reaction

  • 9.6ml of PCR Supermix High Fidelity
  • 67 ul of primer SB-prep-2Eb
  • 67 ul of primer SB-prep-3P-1
  • 10 ul of template DNA at 10ng/ul (100ng total)
    • Notes:
    1. Do not use a sample of linearized plasmid backbones (PCRed) as a template,
    2. The Registry uses plasmid backbones with a BBa_J04450 insert as a template
  • Aliquot 100ul per well in 96 well plate

PCR program

  1. 95C/2min
  2. 95C/30s
  3. 55C/30s
  4. 68C/3min
  5. Repeat cycle (steps 2 to 4, 37 more times)
  6. 68C/10min

PCR cleanup

Purification of 96 well plates was done through Promega [http://www.promega.com/products/dna-and-rna-purification/dna-fragment-purification/wizard-sv-96-pcr-clean_up-system/ Wizard SV 96 PCR Clean-Up kit] and a vacuum manifold. The protocol below follows the manual, with a few changes (in bold), however please see manual for setup instructions.

  1. Add equal volume of Binding Solution to PCR product (add 100ul of Binding Solution to 100ul of product)
  2. Mix by pipetting, transfer all 200ul to Binding Plate, let sit for 1 min
  3. Apply vacuum until samples pass through, about 30s to 1 min
  4. Add 200 ul of freshly prepared 80% ethanol to Binding Plate, let sit for 1min, apply vacuum until ethanol passes through, about 20s to 1 min.
  5. Repeat ethanol wash (step 4) twice more for three washes total
  6. Remove Binding Plate from wash manifold, blot on kim wipes, reinstall in wash manifold
  7. Apply vacuum for 4 min to fully dry Binding Plate
  8. Remove Binding Plate from wash manifold, blot on kim wipes, reinstall in collection manifold
  9. Add 50ul of TE buffer, let sit for 1 min, apply vacuum until eluted, about 1 min
  10. Repeat 50ul elution (step 9) for a total elution of 100ul
  11. Measure concentration on nanodrop, adjust to 25 ng/ul with TE


Single Reaction PCR

PCR mix

  • 100 ul [http://products.invitrogen.com/ivgn/product/10790020?ICID=search-10790020 PCR Supermix High Fidelity]
  • 0.7 ul of SB-prep-3P-1
  • 0.7 ul of SB-prep-2Ea
  • 0.5 ul template DNA at 10 ng/ul
    • Notes:
    1. Do not use a sample of linearized plasmid backbones (PCRed) as a template,
    2. The Registry uses BBa_J04450 as a template

PCR program

  1. 94C/2min
  2. 94C/30s
  3. 55C/30s
  4. 68C/3min
  5. Repeat cycle (steps 2 to 4, 35 more times)
  6. 68C/10min
  7. Digest with DpnI enzyme: 2ul in 100ul reaction, incubate 37C/hour; heat kill 80C/20min

PCR cleanup

[http://www.qiagen.com/products/dnacleanup/gelpcrsicleanupsystems/qiaquickpcrpurificationkit.aspx QIAquick PCR Purification]

  • Add 500 ul Qiagen buffer PB
  • Spin through a column twice, discard flowthrough
  • Wash 1x with 700 ul buffer PB
  • Wash 2x with 760 ul buffer PE
  • Discard liquid, spin dry at 17000g for 3 min
  • Elute into a new tube twice with 50 ul of TE (100 ul total)


Quality Control

We recommend QCing constructed linearized plasmid backbones, to test success of PCR, ligation efficiency, and background.

  1. Run unpurified PCR product (1 ul) on a gel to verify the correct band and concentration and lack of side products.
  2. Test concentration of purified PCR product. Note: Expected yield should be 40ng/ul or higher. Adjust to 25ng/ul with TE.
  3. Run a digest and ligation test with purified PCR product to determine EcoRI and PstI cutting and ligation efficiency.


Digest

  • Digest Master Mix (10rxns)
    • 15 ul NEB Buffer 2
    • 1.5 ul BSA
    • 90 ul dH20
  • Run Digest
    • 4 ul of plasmid backbone (approximately 100 ng)
    • 10.5 ul of Digest Master Mix
    • 0.5 ul either EcoRI-HF or PstI enzyme (not both!)
      • Only one enzyme is used, as you are testing the cutting and ligating efficiency of one enzyme
    • Digest 37C/30min; 80C/20 min
    • Proceed directly to ligation


Ligation

  • Ligation Master Mix (10rxns)
    • 20 ul T4 DNA ligase buffer
    • 5 ul T4 DNA ligase
    • 25 ul water
  • Ligation Test
    • Add 5 ul of ligation master mix to digested product
    • Ligate 16C/30min; 80C/20 min
    • Run all 20 ul on a gel
    • Compare intensity of the single and double length bands. More efficient ligations will show stronger double length bands than single.


Transformation test

  • Transform 1 ul of the diluted final product into highly competent cells
  • Control transform 10 pg of pUC19
  • Plate on the appropriate antibiotic
  • Observe few colonies. Any colonies represent background to the three antibiotic assembly process
  • Quantify the effective amount of remaining circular DNA able to transform