Difference between revisions of "Part:BBa K3416105"

 
(2 intermediate revisions by 2 users not shown)
Line 1: Line 1:
 
 
__NOTOC__
 
__NOTOC__
 
<partinfo>BBa_K3416105 short</partinfo>
 
<partinfo>BBa_K3416105 short</partinfo>
  
 
=Introduction=
 
=Introduction=
[[File:T--Vilnius-Lithuania--FFlogo.png|80px|right|FlavoFlow]]
+
[[File:T--Vilnius-Lithuania--FFlogo.png|100px|right|FlavoFlow]]
  
 
Vilnius-Lithuania iGEM 2020 project [https://2020.igem.org/Team:Vilnius-Lithuania <b>FlavoFlow</b>]includes three goals towards looking for <i>Flavobacterium</i> disease-related problems solutions. The project includes creating a rapid detection kit, based on HDA and LFA, developing an implement for treating a disease, and creating a foundation of edible vaccines.
 
Vilnius-Lithuania iGEM 2020 project [https://2020.igem.org/Team:Vilnius-Lithuania <b>FlavoFlow</b>]includes three goals towards looking for <i>Flavobacterium</i> disease-related problems solutions. The project includes creating a rapid detection kit, based on HDA and LFA, developing an implement for treating a disease, and creating a foundation of edible vaccines.
 
This part was used for the first goal- detection - of the project FlavoFlow.
 
This part was used for the first goal- detection - of the project FlavoFlow.
 
+
__TOC__
 
==Overview==
 
==Overview==
 
Vilnius Lithuania iGEM 2020 team decided to create a <b>lateral flow assay (LFA)</b> test for <i>Flavobacterium</i> identification and detection purposes. <i>F. branchiophilum</i> causes bacterial gill disease in fish. It is essential to detect the infection-causing pathogen as soon as possible so that an appropriate treatment could be started. To do this, our team created a <b>helicase dependent amplification (HDA)-LFA</b> based detection test that in a few hours can identify an exact bacteria.  
 
Vilnius Lithuania iGEM 2020 team decided to create a <b>lateral flow assay (LFA)</b> test for <i>Flavobacterium</i> identification and detection purposes. <i>F. branchiophilum</i> causes bacterial gill disease in fish. It is essential to detect the infection-causing pathogen as soon as possible so that an appropriate treatment could be started. To do this, our team created a <b>helicase dependent amplification (HDA)-LFA</b> based detection test that in a few hours can identify an exact bacteria.  
Line 17: Line 16:
  
 
===Bioinformatic analysis===
 
===Bioinformatic analysis===
Usually, for phylogenetic analysis and identification 16S rRNA gene can be used<sup>1</sup>. For this reason, we developed LFA probes based on this gene sequence. <i>F. branchiophilum</i> <b>16S rRNA gene</b> (AB680752) was chosen as a marker sequence. To make sure that the LFA test is highly specific, we made a multiple sequence alignment with 16S rRNA genes from other species within the same genus using Clustal Omega tool (1. 2. 4.). Unique target sequences for <i>F. branchiophilum</i> LFA probes were selected based on the absence of matching alignments between sequences (Fig. 1).  
+
Usually, for phylogenetic analysis and identification 16S rRNA gene can be used<sup>Janda, J. M. & Abbott, S. L. 16S rRNA Gene Sequencing for Bacterial Identification in the Diagnostic Laboratory: Pluses, Perils, and Pitfalls. <i>Journal of Clinical Microbiology</i>, <b>45</b>, 2761–2764 (2007).</sup>. For this reason, we developed LFA probes based on this gene sequence. <i>F. branchiophilum</i> <b>16S rRNA gene</b> (AB680752) was chosen as a marker sequence. To make sure that the LFA test is highly specific, we made a multiple sequence alignment with 16S rRNA genes from other species within the same genus using Clustal Omega tool (1. 2. 4.). Unique target sequences for <i>F. branchiophilum</i> LFA probes were selected based on the absence of matching alignments between sequences (Fig. 1).  
  
  
Line 35: Line 34:
  
  
===Description of 16S <i>F. branchiophilum</i> detection probe===
+
===Description of 16S <i>F. branchiophilum</i> capture probe===
 
<b>BBa_K3416105</b> is a capture probe that is sprayed on the nitrocellulose membrane with a dispensing system such as BioDot. This sequence must be modified. Our team added a <b>poly-A</b> to make sure that the probe sequence itself is available for hybridization. Also  a <b>biotin moiety</b> (bio, IDT) on the <b>3’ end</b> must be added. Biotin modification is needed so that the probe could be immobilized on the test line of the lateral flow assay test strip via biotin-streptavidin non-covalent interaction.  
 
<b>BBa_K3416105</b> is a capture probe that is sprayed on the nitrocellulose membrane with a dispensing system such as BioDot. This sequence must be modified. Our team added a <b>poly-A</b> to make sure that the probe sequence itself is available for hybridization. Also  a <b>biotin moiety</b> (bio, IDT) on the <b>3’ end</b> must be added. Biotin modification is needed so that the probe could be immobilized on the test line of the lateral flow assay test strip via biotin-streptavidin non-covalent interaction.  
  
Line 48: Line 47:
 
|}
 
|}
  
 +
<!-- -->
 +
<span class='h3bb'>Sequence and Features</span>
 +
<partinfo>BBa_K3416105 SequenceAndFeatures</partinfo>
 +
 +
 +
<!-- Uncomment this to enable Functional Parameter display
 +
===Functional Parameters===
 +
<partinfo>BBa_K3416105 parameters</partinfo>
 +
<!-- -->
  
==References==
+
=References=
#  Janda, J. M. & Abbott, S. L. 16S rRNA Gene Sequencing for Bacterial Identification in the Diagnostic Laboratory: Pluses, Perils, and Pitfalls. <i>Journal of Clinical Microbiology</i>, <b>45</b>, 2761–2764 (2007).
+
<references />
 
#  Liu, B. & Liu, J. Methods for preparing DNA-functionalized gold nanoparticles, a key reagent of bioanalytical chemistry. <i>Anal. Methods</i>, <b>9</b>, 2633–2643 (2017).
 
#  Liu, B. & Liu, J. Methods for preparing DNA-functionalized gold nanoparticles, a key reagent of bioanalytical chemistry. <i>Anal. Methods</i>, <b>9</b>, 2633–2643 (2017).
 
#  Zhang, X., Servos, M. R. & Liu, J. Instantaneous and Quantitative Functionalization of Gold Nanoparticles with Thiolated DNA Using a pH-Assisted and Surfactant-Free Route. <i>J. Am. Chem. Soc.</i>, <b>134</b>, 7266–7269 (2012).
 
#  Zhang, X., Servos, M. R. & Liu, J. Instantaneous and Quantitative Functionalization of Gold Nanoparticles with Thiolated DNA Using a pH-Assisted and Surfactant-Free Route. <i>J. Am. Chem. Soc.</i>, <b>134</b>, 7266–7269 (2012).

Latest revision as of 22:51, 16 December 2020

F. branchiophilum LFA capture probe (16S rRNA)

Introduction

FlavoFlow

Vilnius-Lithuania iGEM 2020 project FlavoFlowincludes three goals towards looking for Flavobacterium disease-related problems solutions. The project includes creating a rapid detection kit, based on HDA and LFA, developing an implement for treating a disease, and creating a foundation of edible vaccines. This part was used for the first goal- detection - of the project FlavoFlow.

Overview

Vilnius Lithuania iGEM 2020 team decided to create a lateral flow assay (LFA) test for Flavobacterium identification and detection purposes. F. branchiophilum causes bacterial gill disease in fish. It is essential to detect the infection-causing pathogen as soon as possible so that an appropriate treatment could be started. To do this, our team created a helicase dependent amplification (HDA)-LFA based detection test that in a few hours can identify an exact bacteria.

Detection system

Lateral flow assay based on nucleic acid requires three single-stranded DNA probes: detection, capture, and control. The main principle of this method is that the added ssDNA amplicon hybridizes to the detection probe as well as capture probe, due to this first visible red line appears, eventually a second line also appears due to the hybridization of control and detection probe. If two lines are present, then the test is positive, if only one is visible - negative.


Bioinformatic analysis

Usually, for phylogenetic analysis and identification 16S rRNA gene can be usedJanda, J. M. & Abbott, S. L. 16S rRNA Gene Sequencing for Bacterial Identification in the Diagnostic Laboratory: Pluses, Perils, and Pitfalls. Journal of Clinical Microbiology, 45, 2761–2764 (2007).. For this reason, we developed LFA probes based on this gene sequence. F. branchiophilum 16S rRNA gene (AB680752) was chosen as a marker sequence. To make sure that the LFA test is highly specific, we made a multiple sequence alignment with 16S rRNA genes from other species within the same genus using Clustal Omega tool (1. 2. 4.). Unique target sequences for F. branchiophilum LFA probes were selected based on the absence of matching alignments between sequences (Fig. 1).


Figure 1. 1 - Flavobacterium species 16S rRNA partial gene sequences alignment. Black boxes highlight sequence parts chosen for probe placement. Gene sequences: F. columnare - AY577821, F. branchiophilum - AB680752, F. psychrophilum - AY662493.


To develop the F. branchiophilum LFA test based on 16S rRNA gene these parts are needed: BBa_K3416104, BBa_K3416105,BBa_K3416106. Primers to amplify a fragment of 16S rRNA are:


F_Bran: GGATAGCCCAGAGAAATTTGGATTA

R_Bran: GGGACGCATGCTCATCTTT

In our case, detection and capture probes were created to be complementary to the negative strand of the gene. All protocols needed to prepare LFA tests as well as to perform HDA can be found in Vilnius-Lithuania iGEM 2020 team wiki page.


Description of 16S F. branchiophilum capture probe

BBa_K3416105 is a capture probe that is sprayed on the nitrocellulose membrane with a dispensing system such as BioDot. This sequence must be modified. Our team added a poly-A to make sure that the probe sequence itself is available for hybridization. Also a biotin moiety (bio, IDT) on the 3’ end must be added. Biotin modification is needed so that the probe could be immobilized on the test line of the lateral flow assay test strip via biotin-streptavidin non-covalent interaction.


Table 1. | Parameters of capture probe created for nucleic acid lateral flow assay test. Tm and GC% was calculated without poly-A sequence using IDT oligo analyzer tool. (A)20 marks poly-A sequence of 20 adenines. Bio means biotin modification.
Species Probe type Sequence and its modification Hybridization site
F. branchiophilum 16S rRNA gene(AB680752) Capture probe GCA TGG TTT TCA C-(A)20-bio 157-169 bp

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]


References

  1. Liu, B. & Liu, J. Methods for preparing DNA-functionalized gold nanoparticles, a key reagent of bioanalytical chemistry. Anal. Methods, 9, 2633–2643 (2017).
  2. Zhang, X., Servos, M. R. & Liu, J. Instantaneous and Quantitative Functionalization of Gold Nanoparticles with Thiolated DNA Using a pH-Assisted and Surfactant-Free Route. J. Am. Chem. Soc., 134, 7266–7269 (2012).