Difference between revisions of "Part:BBa K3416104"
| Line 3: | Line 3: | ||
<partinfo>BBa_K3416104 short</partinfo> | <partinfo>BBa_K3416104 short</partinfo> | ||
| − | + | =Introduction= | |
| + | [[File:T--Vilnius-Lithuania--FFlogo.png|80px|right|FlavoFlow]] | ||
| − | + | Vilnius-Lithuania iGEM 2020 project [https://2020.igem.org/Team:Vilnius-Lithuania <b>FlavoFlow</b>]includes three goals towards looking for <i>Flavobacterium</i> disease-related problems solutions. The project includes creating a rapid detection kit, based on HDA and LFA, developing an implement for treating a disease, and creating a foundation of edible vaccines. | |
| − | + | This part was used for the first goal- detection - of the project FlavoFlow. | |
| − | < | + | ==Overview== |
| − | < | + | Vilnius Lithuania iGEM 2020 team decided to create a <b>lateral flow assay (LFA)</b> test for <i>Flavobacterium</i> identification and detection purposes. <i>F. branchiophilum</i> causes bacterial gill disease in fish. It is essential to detect the infection-causing pathogen as soon as possible so that an appropriate treatment could be started. To do this, our team created a <b>helicase dependent amplification (HDA)-LFA</b> based detection test that in a few hours can identify an exact bacteria. |
| − | < | + | |
| + | ==Detection system== | ||
| + | Lateral flow assay based on nucleic acid requires three single-stranded DNA probes: <b>detection</b>, <b>capture</b>, and <b>control</b>. The main principle of this method is that the added ssDNA amplicon hybridizes to the detection probe as well as capture probe, due to this first visible red line appears, eventually a second line also appears due to the hybridization of control and detection probe. If two lines are present, then the test is <b>positive</b>, if only one is visible - <b>negative</b>. | ||
| − | < | + | |
| − | === | + | ===Bioinformatic analysis=== |
| − | < | + | Usually, for phylogenetic analysis and identification 16S rRNA gene can be used<sup>1</sup>. For this reason, we developed LFA probes based on this gene sequence. <i>F. branchiophilum</i> <b>16S rRNA gene</b> (AB680752) was chosen as a marker sequence. To make sure that the LFA test is highly specific, we made a multiple sequence alignment with 16S rRNA genes from other species within the same genus using Clustal Omega tool (1. 2. 4.). Unique target sequences for <i>F. branchiophilum</i> LFA probes were selected based on the absence of matching alignments between sequences (Fig. 1). |
| − | < | + | |
| + | |||
| + | [[File: Paliginys.png |thumb|600px|center|<b>Figure 1.</b> <b>1</b> - <i>Flavobacterium</i> species 16S rRNA partial gene sequences alignment. Black boxes highlight sequence parts chosen for probe placement. Gene sequences: <i>F. columnare</i> - AY577821, <i>F. branchiophilum</i> - AB680752, <i>F. psychrophilum</i> - AY662493. | ||
| + | ]] | ||
| + | |||
| + | |||
| + | |||
| + | To develop the <i>F. branchiophilum</i> LFA test based on 16S rRNA gene these parts are needed: <b>[https://parts.igem.org/Part:BBa_K3416104 BBa_K3416104,] [https://parts.igem.org/Part:BBa_K3416105 BBa_K3416105,][https://parts.igem.org/Part:BBa_K3416106 BBa_K3416106.]</b> Primers to amplify a fragment of 16S rRNA are: | ||
| + | |||
| + | |||
| + | <b>F_Bran</b>: GGATAGCCCAGAGAAATTTGGATTA | ||
| + | |||
| + | <b>R_Bran</b>: GGGACGCATGCTCATCTTT | ||
| + | |||
| + | In our case, detection and capture probes were created to be complementary to the negative strand of the gene. All protocols needed to prepare LFA tests as well as to perform HDA can be found in [https://2020.igem.org/Team:Vilnius-Lithuania/Experiments Vilnius-Lithuania iGEM 2020 team wiki page.] | ||
| + | |||
| + | |||
| + | ===Description of 16S <i>F. branchiophilum</i> detection probe=== | ||
| + | <b>BBa_K3416104</b> is a detection probe used to functionalize gold nanoparticles, meaning that a part of the sequence is adsorbed by gold nanoparticle. This basic part is only the DNA sequence itself, but for successful LFA test development, modifications are needed. Without <b>thiol group</b> modification detection probe sequence can lose its molecular recognition function after conjugation to gold nanoparticle<sup>3</sup>. For this reason, a thiol group (ThioMC6-D, IDT) must be added to the <b>5’ end</b>. Also, the probe should contain a <b>poly-A</b> sequence for efficient gold nanoparticles functionalization using a low pH method<sup>4</sup>. The rest of the sequence is left free for hybridization. Thiol group reacts with gold nanoparticle and allows efficient functionalization reaction. | ||
| + | |||
| + | |||
| + | |||
| + | {| class="wikitable" | ||
| + | |+ style="text-align: left;" | <b>Table 1.</b> | Parameters of capture probe created for nucleic acid lateral flow assay test. Tm and GC% was calculated without poly-A sequence using IDT oligo analyzer tool. (A)20 marks poly-A sequence of 20 adenines. Bio means biotin modification. | ||
| + | |- | ||
| + | | <b>Species</b> || <b>Probe type</b> || <b>Sequence and its modification</b> || <b>Hybridization site</b> | ||
| + | |- | ||
| + | | F. branchiophilum 16S rRNA gene(AB680752) || Detection probe || ThioMC6-D-AAAAAAAAAAAAAAAAAAAAGTGATGATC || 148-156 bp | ||
| + | |} | ||
| + | |||
| + | |||
| + | ==References== | ||
| + | # Janda, J. M. & Abbott, S. L. 16S rRNA Gene Sequencing for Bacterial Identification in the Diagnostic Laboratory: Pluses, Perils, and Pitfalls. <i>Journal of Clinical Microbiology</i>, <b>45</b>, 2761–2764 (2007). | ||
| + | # Liu, B. & Liu, J. Methods for preparing DNA-functionalized gold nanoparticles, a key reagent of bioanalytical chemistry. <i>Anal. Methods</i>, <b>9</b>, 2633–2643 (2017). | ||
| + | # Zhang, X., Servos, M. R. & Liu, J. Instantaneous and Quantitative Functionalization of Gold Nanoparticles with Thiolated DNA Using a pH-Assisted and Surfactant-Free Route. <i>J. Am. Chem. Soc.</i>, <b>134</b>, 7266–7269 (2012). | ||
Revision as of 02:01, 28 October 2020
F. branchiophilum LFA detection probe (16S rRNA)
Introduction
Vilnius-Lithuania iGEM 2020 project FlavoFlowincludes three goals towards looking for Flavobacterium disease-related problems solutions. The project includes creating a rapid detection kit, based on HDA and LFA, developing an implement for treating a disease, and creating a foundation of edible vaccines. This part was used for the first goal- detection - of the project FlavoFlow.
Overview
Vilnius Lithuania iGEM 2020 team decided to create a lateral flow assay (LFA) test for Flavobacterium identification and detection purposes. F. branchiophilum causes bacterial gill disease in fish. It is essential to detect the infection-causing pathogen as soon as possible so that an appropriate treatment could be started. To do this, our team created a helicase dependent amplification (HDA)-LFA based detection test that in a few hours can identify an exact bacteria.
Detection system
Lateral flow assay based on nucleic acid requires three single-stranded DNA probes: detection, capture, and control. The main principle of this method is that the added ssDNA amplicon hybridizes to the detection probe as well as capture probe, due to this first visible red line appears, eventually a second line also appears due to the hybridization of control and detection probe. If two lines are present, then the test is positive, if only one is visible - negative.
Bioinformatic analysis
Usually, for phylogenetic analysis and identification 16S rRNA gene can be used1. For this reason, we developed LFA probes based on this gene sequence. F. branchiophilum 16S rRNA gene (AB680752) was chosen as a marker sequence. To make sure that the LFA test is highly specific, we made a multiple sequence alignment with 16S rRNA genes from other species within the same genus using Clustal Omega tool (1. 2. 4.). Unique target sequences for F. branchiophilum LFA probes were selected based on the absence of matching alignments between sequences (Fig. 1).
To develop the F. branchiophilum LFA test based on 16S rRNA gene these parts are needed: BBa_K3416104, BBa_K3416105,BBa_K3416106. Primers to amplify a fragment of 16S rRNA are:
F_Bran: GGATAGCCCAGAGAAATTTGGATTA
R_Bran: GGGACGCATGCTCATCTTT
In our case, detection and capture probes were created to be complementary to the negative strand of the gene. All protocols needed to prepare LFA tests as well as to perform HDA can be found in Vilnius-Lithuania iGEM 2020 team wiki page.
Description of 16S F. branchiophilum detection probe
BBa_K3416104 is a detection probe used to functionalize gold nanoparticles, meaning that a part of the sequence is adsorbed by gold nanoparticle. This basic part is only the DNA sequence itself, but for successful LFA test development, modifications are needed. Without thiol group modification detection probe sequence can lose its molecular recognition function after conjugation to gold nanoparticle3. For this reason, a thiol group (ThioMC6-D, IDT) must be added to the 5’ end. Also, the probe should contain a poly-A sequence for efficient gold nanoparticles functionalization using a low pH method4. The rest of the sequence is left free for hybridization. Thiol group reacts with gold nanoparticle and allows efficient functionalization reaction.
| Species | Probe type | Sequence and its modification | Hybridization site |
| F. branchiophilum 16S rRNA gene(AB680752) | Detection probe | ThioMC6-D-AAAAAAAAAAAAAAAAAAAAGTGATGATC | 148-156 bp |
References
- Janda, J. M. & Abbott, S. L. 16S rRNA Gene Sequencing for Bacterial Identification in the Diagnostic Laboratory: Pluses, Perils, and Pitfalls. Journal of Clinical Microbiology, 45, 2761–2764 (2007).
- Liu, B. & Liu, J. Methods for preparing DNA-functionalized gold nanoparticles, a key reagent of bioanalytical chemistry. Anal. Methods, 9, 2633–2643 (2017).
- Zhang, X., Servos, M. R. & Liu, J. Instantaneous and Quantitative Functionalization of Gold Nanoparticles with Thiolated DNA Using a pH-Assisted and Surfactant-Free Route. J. Am. Chem. Soc., 134, 7266–7269 (2012).