Difference between revisions of "Part:BBa K3424025:Design"

(References)
 
(One intermediate revision by the same user not shown)
Line 1: Line 1:
 
===Source===
 
===Source===
  
RiboJ insulator DNA sequence (Meyer 4): AGCTGTCACCGGATGTGCTTTCCGGTCTGATGAGTCCGTGAGGACGAAACAGCCTCTACAAATAATTTTGTTTAA
+
https://static-content.springer.com/esm/art%3A10.1038%2Fs41589-018-0168-3/MediaObjects/41589_2018_168_MOESM1_ESM.pdf?fbclid=IwAR22C9bYtULbPECeq8TFaAhzM7D4_RDMQ9SoeSoqnM6OdHqtg_-hpK6GoXE
  
 
===References===
 
===References===
 
Clifton, K., Jones, E., Paudel, S., Marken, J., Monette, C., Halleran, A., et al. (2018). The genetic insulator RiboJ increases expression of insulated genes. Journal of Biological Engineering. 12(23). doi: 10.1186/s13036-018-0115-6.
 
Clifton, K., Jones, E., Paudel, S., Marken, J., Monette, C., Halleran, A., et al. (2018). The genetic insulator RiboJ increases expression of insulated genes. Journal of Biological Engineering. 12(23). doi: 10.1186/s13036-018-0115-6.
 
Luo, C., Stanton, B., Chen, Y., Munsky, B. and Voight, C. (2012). Ribozyme-based insulator parts buffer synthetic circuits from genetic context. Nat Biotechnol. 30(11): 1137-1142.
 
Luo, C., Stanton, B., Chen, Y., Munsky, B. and Voight, C. (2012). Ribozyme-based insulator parts buffer synthetic circuits from genetic context. Nat Biotechnol. 30(11): 1137-1142.
 +
 
Meyer, A., Segall-Shapiro, T., Glassey E., Zhang, J. and Voigt, C. (2019). Escherichia coli “Marionnette” strains with 12 highly optimized small-molecule sensors. Nature Chemical Biology. 15:196-204.
 
Meyer, A., Segall-Shapiro, T., Glassey E., Zhang, J. and Voigt, C. (2019). Escherichia coli “Marionnette” strains with 12 highly optimized small-molecule sensors. Nature Chemical Biology. 15:196-204.

Latest revision as of 20:32, 27 October 2020

Source

https://static-content.springer.com/esm/art%3A10.1038%2Fs41589-018-0168-3/MediaObjects/41589_2018_168_MOESM1_ESM.pdf?fbclid=IwAR22C9bYtULbPECeq8TFaAhzM7D4_RDMQ9SoeSoqnM6OdHqtg_-hpK6GoXE

References

Clifton, K., Jones, E., Paudel, S., Marken, J., Monette, C., Halleran, A., et al. (2018). The genetic insulator RiboJ increases expression of insulated genes. Journal of Biological Engineering. 12(23). doi: 10.1186/s13036-018-0115-6. Luo, C., Stanton, B., Chen, Y., Munsky, B. and Voight, C. (2012). Ribozyme-based insulator parts buffer synthetic circuits from genetic context. Nat Biotechnol. 30(11): 1137-1142.

Meyer, A., Segall-Shapiro, T., Glassey E., Zhang, J. and Voigt, C. (2019). Escherichia coli “Marionnette” strains with 12 highly optimized small-molecule sensors. Nature Chemical Biology. 15:196-204.