Difference between revisions of "Part:BBa K142001"

Latest revision as of 03:39, 30 October 2008

lacI IS mutant (IPTG unresponsive) R197F

Short description: The lacI IS mutant is almost identical to the lacI transcriptional regulator except for the difference that it is not able to bind IPTG or allolactose due to a mutation; it therefore can not be activated by induction with these substances. Since it recognizes the same motif in the lac promotor region, it strongly represses transcription of all genes regulated by promotors with lacI binding site even if IPTG or allolactose are present. It can be used to terminate the expression of proteins under lac control if IPTG can not be removed from the cell rapidly.

Detailed description: Expression of the lac operon in E. coli is tightly controlled by lacI, a protein, which binds to a repressor binding site within the promotor and disables transcription by obscuring the promotor region. When bound to DNA, lacI is in the tetrameric form, which consists of two dimers interacting at the end distal from the DNA binding site. Upon binding of allolactose or IPTG, the tetramer breaks down into two dimers and the affinity for the repressor binding site is greatly reduced; the lacI IPTG complex will diffuse away from the repressor binding site, leaving the promotor accessible. As a result of decades of genetic and structural studies, the function of lacI is now understood on the molecular level (1, 2). Mutational experiments have identified residues, which abolish IPTG response upon mutation (3). Furthermore, the x-ray crystal structure of lacI with bound IPTG has allowed the identification of residues that interact with IPTG and which are promising targets for mutagenesis (1). We decided to mutate residues R197 and T276, which are located in the IPTG binding groove, contact IPTG and have been shown to produce the lacI IS mutation in previous genetic experiments. Since a quantitative study of the strength of inhibition by different lacI IS mutants has to our knowledge not been published so far, we decided to generate a set of eight mutated lacIs, in which we replaced either R197 with alanine or phenylalanine or T276 with alanine or phenylalanine or both in all possible combinations.

lacIIS-1: R197A

lacIIS-2: R197F

lacIIS-3: T276A

lacIIS-4: T276F

lacIIS-5: R197A T276A

lacIIS-6: R197A T276F

lacIIS-7: R197F T276A

lacIIS-8: R197F T276F

References:

(1) Lewis, M., Chang, G., Horton, N. C., Kercher, M. A., Pace, H. C., Schumacher, M. A., Brennan, R. G., and Lu, P. (1996) Crystal structure of the lactose operon repressor and its complexes with DNA and inducer. Science 271, 1247-54.

(2) Friedman, A. M., Fischmann, T. O., and Steitz, T. A. (1995) Crystal structure of lac repressor core tetramer and its implications for DNA looping. Science 268, 1721-7.

(3) Suckow, J., Markiewicz, P., Kleina, L. G., Miller, J., Kisters-Woike, B., and Muller-Hill, B. (1996) Genetic studies of the Lac repressor. XV: 4000 single amino acid substitutions and analysis of the resulting phenotypes on the basis of the protein structure. J Mol Biol 261, 509-23.

Usage and Biology

Estimate of LacI IS repressor strength

In order to characterize the lacI IS mutants generated – especially with respect to the double mutants – we performed a series of simple genetic experiments, which would allow us to identify promising mutations and reject mutations that allow significant induction at IPTG concentrations regularly used for induction (usually between 0.1mM and 1mM). Ideally, the experiment would link repression of a lac inducible gene to a marked change in cell growth or morphology. We decided to use ribosome modulation factor (RMF) in a series of genetic experiments.

Ribosome modulation factor (RMF) experiments

Ribosome modulation factor (RMF, Uniprot [http://www.uniprot.org/uniprot/P0AFW2 P0AFW2]) is a small protein, which is found in many bacteria. RMF is expressed when bacterial cultures reach the stationary phase (1, 2) and terminates protein synthesis efficiently by binding to ribosomes. Biochemical studies have shown that expression of RMF leads to dimerization of ribosomes (the bacterial 70S ribosomes form a complex with a sedimentation velocity of 100S) and chemical crosslinking studies elucidated that RMF binds to the peptidyl transferase center (3, 4). Since expression of RMF reversibly terminates protein expression and thereby stops bacterial growth we used RMF to determine the extent of lac repression by mutant lacI repressors.

Figure 1: A Schematic representation of vector pET28a. Not that the vector has a constitutive LacI expression cassette. B BL21 DE3 cells holding the empty pET28a vector at 10mM IPTG. The vector is obviously nontoxic to cells even at high concentrations of inducer. C Decreased viability of BL21 DE3 cells harboring vector pET28a-RMF wild type at 1mM IPTG and 10mM IPTG.

For our genetic experiment, we took advantage of two properties of the pET expression system. The pET expression system shows an extremely low degree of leaky expression and is therefore ideal for expression of toxic genes. In order to increase repression of lac-controlled expression in absence of inducer, the pET vector series contains a constitutive LacI expression cassette encoding a lacI gene that is identical to the lacI gene provided by the registry as part I763026 and can therefore be converted by simple site-directed mutagenesis into the LacI IS mutants we set out to study. In order to find out whether the LacI IS mutants were able to rescue a BL21 DE3 cell harboring the mutated pET28a-RMF plasmid at even elevated concentrations of inducer, we subcloned RMF into the expression vector and subjected the expression vector to site-directed mutagenesis. In addition, we tested the impact of empty plasmid and pET28a-RMF with wild-type lacI on the viability of cells at elevated IPTG concentrations.

In order to perform this genetic experiment, we amplified RMF from E. coli strain DH5-alpha DNA using forward primer 5’-cgcggatccgaaaacctgtattttcagggcaagagacaaaaacgagatcgcctg and reverse primer 5’-ccgctcgagttattaggccattactaccctgtcc (reaction setup was 35ul water, 10ul [http://www.finnzymes.com/highperformancepcr.html Finnzyme] Phusion HF buffer, 1ul 10mM dNTPs, 1ul 25uM forward primer, 1ul 25uM reverse primer, 0.5ul DH5-alpha genomic DNA, 0.5ul [http://www.finnzymes.com/highperformancepcr.html Finnzyme] Phusion Hot-start polymerase; thermocycler program was 98C for 3min, cycle start: 98C for 10s, 55C for 30s, 72C for 10s, cycle end, 35 repeats, 72C for 30min, 4C hold). We subsequently digested the PCR product with XhoI and BamHI and subcloned it into the pET28a vector ([http://www.merckbiosciences.com/g.asp?f=NVG/pETtable.html Novagen]) multiple cloning site. The sequence of the RMF insert was verified by sequencing. In order to determine whether the construct is expressed correctly and in order to verify the physiological reaction of E. coli cells to expression of RMF, we electroporated pET28a-RMF into BL21 DE3 cells (which hold a T7 polymerase gene on their genome and are therefore able to express genes under the T7 promoter) and plated the cells on LB-agar plates supplemented with kanamycin and found growth strongly diminished upon plating cells on IPTG containing plates. In order to verify the termination of growth after induction of RMF expression in liquid culture, we grew cells holding the plasmid in shake flasks and found that growth terminates rapidly upon induction. We prepared ribosomes from induced cells and measured their sedimentation velocity. Induced cells contain two poulations of ribosomes, one with a sedimentation velocity of 70S (suggesting monomeric ribosomes) and the other with a sedimentation velocity of 100S (suggesting dimers). Analysis of the different fractions by negative-stain transmission electron microscopy confirmed that both fractions consist of ribosomes although both of them appear monomeric in the electron microscope (probably the interaction is very weak and breaks up upon adsorption onto the carbon grid; an image of dimeric ribosomes seen in the electron microscope after the sample was treated with substantial amounts of glutaraldehyde has been published previously (4)). The two populations of ribosomes are equally found in uninduced cells, which have progressed into the stationary phase of growth, while the 100S fraction is diminished in cells during log phase and absent in RMF-knockouts (4).

Figure 2: A Growth curve of BL21 DE3 cells holding the pET28a-RMF plasmid without induction (uninduced) and after induction after 5 hours. Cells were grown in 1l of medium in 5l baffled flasks (37C, 95rpm) and induced with 1mM IPTG once they had reached the exponential phase. B Ribosome profile of cells in the stationary phase and after RMF induction. Cells were harvested by centrifugation (Sorvall SLC-6000 rotor, 7200rpm, 10min, 4C) and disrupted in a cell disruptor (Constant systems). The lysate was cleared at 13000 rpm in a SLA-1500 rotor in a Sorvall refrigerated centrifuge. Supernatant was collected and layered on top of a 30% sucrose solution (50mM HEPES-KOH pH 7.6; 100mM KCl; 10mM MgCl2; 1mM DTT). After centrifugation at 50000rpm for 20 hours at 4C in the preparative ultracentrifuge using a Ti70 rotor ([http://www.beckmancoulter.com Beckman Coulter]) the supernatant was decanted and the pellet resuspended in ribosome buffer (50mM HEPES-KOH pH 7.6; 100mM KCl; 10mM MgCl2; 1mM DTT). The resuspended ribosomes were layered on top of a 10 to 40% (w/w) sucrose gradient, which was centrifuged in the SW32 swing rotor ([http://www.beckmancoulter.com Beckman Coulter]) at 28000 rpm for 7 hours. Ribosome bands were visualized by [http://en.wikipedia.org/wiki/Tyndall_effect light scattering] and photographed with a Nikon D80 SLR. C and D Electron micrographs of the 70S and 100S fraction show monomeric ribosomes in both fractions as the only macromolecular constituent. Ribosome samples were diluted to OD260 = 1. 7ul of ribosome solution was added to a glow discharged carbon grid ([http://www.quantifoil.com Quantifoil]) and stained with uranyl acetate according to standard protocol (1min sample adsorption, three times washing with 1% uranyl acetate solution by floatation). Samples were imaged with a [http://www.fei.com FEI] Morgagni 268 transmission electron microscope with tungsten emitter at an acceleration voltage of 100kV; 30000x magnification and recorded with a post column Gatan CCD camera.

We took advantage of the constitutive lac expression cassette in the pET28a vector and used PCR-based site-directed mutagenesis to introduce lacI IS muations into the lacI generator of the pET28a-RMF vector. In order to perform this mutagenesis, we used forward primers

R197F forward 5’-CGGCGCGTCTGTTTCTGGCTGGCTG

R197A forward 5’-CGGCGCGTCTGGCGCTGGCTGGCTG

T276F forward 5’-GGATACGACGATTTTGAAGACAGCTC

T276A forward 5’-GGATACGACGATGCGGAAGACAGCTC

and reverse primers

R197F reverse 5’-CAGCCAGCCAGAAACAGACGCGCCG

R197A reverse 5’-CAGCCAGCCAGCGCCAGACGCGCCG

T276F reverse 5’-GAGCTGTCTTCAAAATCGTCGTATCC

T276A reverse 5’-GAGCTGTCTTCCGCATCGTCGTATCC

to introduce either a single mutation or double mutations. PCR was performed using vector pET28a-RMF as template according to the following protocol: Each reaction setup contained 35ul water, 10ul [http://www.finnzymes.com/highperformancepcr.html Finnzyme] Phusion polymerase HF buffer, 1ul 10mM dNTPs, 5ul primer mix (primers at 100ng/ul), 1ul of diluted DNA template (approximate concentration after dilution 10ng/ul), 0.5ul [http://www.finnzymes.com/highperformancepcr.html Finnzyme] Phusion Hot Start polymerase. The reaction was run with the following thermocycler program: 95C for 30sec, cycle start, 95C 30 sec, 55C 1min, 72C 3min, cycle end, 18 repeats, 72C for 30min, 4C hold. After the PCR reaction had gone to completion, 10ul of 50mM MgCl2 were added to each reaction tube to adjust the magnesium concentration for DpnI restriction digest and the contents were thoroughly mixed. 1ul of DpnI ([http://www.neb.com NEB], equivalent to 20 units) were added to each tube and the contents were thoroughly mixed. The reaction was incubated in the thermocycler: 37C for 120min, 4C hold. Samples were purified with Qiagen Qiaquick PCR purification kit and electroporated into BL21 DE3 cells. Transformation into BL21 DE3 cells yielded numerous colonies. For each construct eight colonies were streaked out on LB-agar supplemented with kanamycin. In order to test the repressor strength we streaked each of these clones onto plates of progressively higher IPTG concentration and monitored the growth. As a control, the unmodified vector was streaked out on plates without, with 1mM IPTG and with 10mM IPTG and IPTG toxicity was assayed by streaking cells holding an empty pET28a vector onto a 10mM IPTG plate. While empty pET28a vector is apparently not toxic for cells even at 10mM IPTG, pET28a-RMF wild type vector prevents growth even at low concentrations of IPTG as expected. Although single colonies can be seen even at 10mM IPTG, it can be assumed that they originate from point mutations that either mutated the T7 gene, the promoter of T7 or RMF or the RMF gene. It is obvious that the great majority of cells is unviable even at 1mM IPTG and the colonies are expected to arise from single aberrations. With the mutated lacI IS as a major source of repressor we assumed that cells would be viable even at high IPTG concentration, since expression of RMF would be repressed by the mutated, IPTG-insensitive LacI IS. Indeed, cells grew normally up to an IPTG concentration of 10mM, which is 10- to 100-fold the concentration usually used for induction and, as can be seen in the corresponding figure, growth was even more pronounced at IPTG concentrations of 1mM or even 10mM compared to growth without induction. This behavior is difficult to explain. The LacI expression cassette used in the pET vector series (accession number: [http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?val=EF442785 EF442785]) appears to be controlled by the standard promoter TCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTA taken from E. coli. This promoter is a weak, constitutive promoter, which does not appear to be regulated by IPTG, since it does not show sequence motifs reminiscent of the lac repressor binding site. It can be assumed that the population of lac repressors in the cell is dominated by the repressor mutant rather than by the wild type, since the mutant is expressed from hundreds of plasmids, while the wildtype is expressed from a single gene on the E. coli chromosome. While the wild type repressor will dissociate from the repressor binding site upstream of the T7 gene, the LacI IS mutant will not. Since IPTG does not change the ratio of repressor to activator, it is difficult to explain why cells grew slightly denser at elevated IPTG concentration.

Figure 3: Cell viability at increasing IPTG concentration. BL21 DE3 cells holding the pET28a-RMF wildtype plasmid (control) and mutations R197A; R197F; T276A; T276F; R197A T276A; R197A T276F; R197F T276A; R197F T276F were plated on LB-agar with kanamycin without IPTG, with 1mM IPTG and with 10mM IPTG

Since all mutants restored viability of cells at 1mM and even at 10mM IPTG, we assume that all mutants we have generated strongly repress expression under lac control. Although we have not been able to obtain sequences of the mutations yet, we are confident that all described mutants strongly repress lac-controlled expression.

References

(1) Yamagishi, M., Matsushima, H., Wada, A., Sakagami, M., Fujita, N., and Ishihama, A. (1993) Regulation of the Escherichia coli rmf gene encoding the ribosome modulation factor: growth phase- and growth rate-dependent control. Embo J 12, 625-30. (2) Wada, A., Yamazaki, Y., Fujita, N., and Ishihama, A. (1990) Structure and probable genetic location of a "ribosome modulation factor" associated with 100S ribosomes in stationary-phase Escherichia coli cells. Proc Natl Acad Sci U S A 87, 2657-61. (3) Yoshida, H., Yamamoto, H., Uchiumi, T., and Wada, A. (2004) RMF inactivates ribosomes by covering the peptidyl transferase centre and entrance of peptide exit tunnel. Genes Cells 9, 271-8. (4) Yoshida, H., Maki, Y., Kato, H., Fujisawa, H., Izutsu, K., Wada, C., and Wada, A. (2002) The ribosome modulation factor (RMF) binding site on the 100S ribosome of Escherichia coli. J Biochem 132, 983-9.

Sequence and Features