Difference between revisions of "Part:BBa K1157001:Experience"
(→‎User Reviews)
Line 8: Line 8:
 
===User Reviews===
 
===User Reviews===
 
<!-- DON'T DELETE --><partinfo>BBa_K1157001 StartReviews</partinfo>
 
<!-- DON'T DELETE --><partinfo>BBa_K1157001 StartReviews</partinfo>
 +
{|width='80%' style='border:1px solid gray'
 +
|-
 +
|width='10%'|
 +
<partinfo>BBa_K1157001 AddReview 2</partinfo>
 +
<I>iGEM WHU-China 2020</I>
 +
|width='60%' valign='top'|
 +
 +
Since this part is derived from the original ''Pseudomonas aeruginosa'' PAO1 genome sequence, and the GC content distribution is relatively high, we recommend to obtain the target gene by colony PCR rather than synthesis.
 +
<br/>
 +
PF: 5'gctctagatgcctattcataacctgaatcacgtg3'
 +
<br/>
 +
PR: 5'gcactagtattattactctggtgcggcgc3'
 +
<br/>
 +
Here is a set of primer pairs that we have verified. PF adds Xba1 cleavage site, and PR adds Spe1 cleavage site.
 +
<br/>
 +
[[image:PqsR PCR.png|thumb|left|250px|colony PCR of PqsR]]
  
 
{|width='80%' style='border:1px solid gray'
 
{|width='80%' style='border:1px solid gray'

Revision as of 16:29, 26 October 2020


This experience page is provided so that any user may enter their experience using this part.
Please enter how you used this part and how it worked out.

Applications of BBa_K1157001

User Reviews

UNIQec7c252f0e4351ad-partinfo-00000000-QINU

••

iGEM WHU-China 2020

Since this part is derived from the original Pseudomonas aeruginosa PAO1 genome sequence, and the GC content distribution is relatively high, we recommend to obtain the target gene by colony PCR rather than synthesis.
PF: 5'gctctagatgcctattcataacctgaatcacgtg3'
PR: 5'gcactagtattattactctggtgcggcgc3'
Here is a set of primer pairs that we have verified. PF adds Xba1 cleavage site, and PR adds Spe1 cleavage site.

colony PCR of PqsR
••

iGEM Dundee 2014

We made an exact twin of this PqsR-encoding part and rather than send it to The Registry we decided to call our version BBa_K1157001 out of respect for NTU and use it for our 2014 project. We added an HA epitope tag and showed that the protein was produced in an E. coli chassis (Dundee Figure 1) when expressed from an in-house vector called pUNI-PROM. This part was used in conjunction with a pqsA promoter that we submitted as BBa_K1315001.

Dundee 2014 Figure 1 Western blot of HA-tagged PqsR

UNIQec7c252f0e4351ad-partinfo-00000005-QINU