Difference between revisions of "Collections/Immune Regulation"
Soumo sarkar (Talk | contribs) |
Soumo sarkar (Talk | contribs) (→Devices) |
||
(2 intermediate revisions by 2 users not shown) | |||
Line 3: | Line 3: | ||
The immune system requires a homeostatic balance of the components involved. It is part of the complex biological response of the body to several substances such as pathogen, antigens, allergens, etc. It is a protective mechanism that is triggered by several signals (oxidative stress, signal peptides, receptors, etc) and is regulated by the balance of pro and anti-inflammatory substances. | The immune system requires a homeostatic balance of the components involved. It is part of the complex biological response of the body to several substances such as pathogen, antigens, allergens, etc. It is a protective mechanism that is triggered by several signals (oxidative stress, signal peptides, receptors, etc) and is regulated by the balance of pro and anti-inflammatory substances. | ||
− | In order to help future teams to engineer safe, effective, and required responses, we have curated the Immune regulation collection with the parts that have been designed and used by other previous teams. | + | In order to help future teams to engineer safe, effective, and required responses, we have curated the <b>Immune regulation</b> collection with the parts that have been designed and used by other previous teams. |
The collection is divided into sense and control, pro and anti-inflammatory substances, antibodies, receptors, and composite control mechanism devices to enable easy access during design. | The collection is divided into sense and control, pro and anti-inflammatory substances, antibodies, receptors, and composite control mechanism devices to enable easy access during design. | ||
In case your iGEM team has designed a new part that involves any of these aspects, please do add on to the collection. | In case your iGEM team has designed a new part that involves any of these aspects, please do add on to the collection. | ||
Line 31: | Line 31: | ||
This set contains other miscellaneous molecules whose functions are related to the immune system. | This set contains other miscellaneous molecules whose functions are related to the immune system. | ||
<parttable>coll_immune_regulation_others</parttable> | <parttable>coll_immune_regulation_others</parttable> | ||
+ | |||
+ | |||
+ | ===Devices=== | ||
+ | This set contains composite parts used by previous iGEM teams. | ||
+ | <parttable>coll_immune_regulation_devices</parttable> |
Latest revision as of 15:41, 26 October 2020
The immune system requires a homeostatic balance of the components involved. It is part of the complex biological response of the body to several substances such as pathogen, antigens, allergens, etc. It is a protective mechanism that is triggered by several signals (oxidative stress, signal peptides, receptors, etc) and is regulated by the balance of pro and anti-inflammatory substances. In order to help future teams to engineer safe, effective, and required responses, we have curated the Immune regulation collection with the parts that have been designed and used by other previous teams. The collection is divided into sense and control, pro and anti-inflammatory substances, antibodies, receptors, and composite control mechanism devices to enable easy access during design. In case your iGEM team has designed a new part that involves any of these aspects, please do add on to the collection.
Sense & Control
Accidental release of inflammatory molecules can prove to be dangerous to the human body. These are parts that activate certain mechanisms like inflammatory responses only under particular conditions. eg: presence of certain pro-inflammatory compounds/molecules
Name | Description | Type | Created by | length | uses | seq |
---|---|---|---|---|---|---|
BBa_K1799015 | pYeaR | Regulatory | Will Shindel | 100 | . . . aatgcaaattatcaggcgtaccctgaaacg | |
BBa_K203111 | Constitutive promoter; 2 REU | Regulatory | Lars Velten, Simon Haas, Hannah Meyer, Anne Rademacher, Hannah Uckelmann and Corinna Hiller | 426 | . . . gccgggatttgggtcgcggttcttgtttgt | |
BBa_K256004 | NorR | Coding | iGEM09_NTU-Singapore | 1515 | 6 | . . . ctggcgaaacgtctgggattgaaggattaa |
BBa_K2976009 | NF-κB induced promoter | Regulatory | Jiatong Chen | 109 | 2 | . . . gtacggtgggaggtctatataagcagagct |
BBa_K3244013 | NFAT-Response Ellement | Regulatory | Mohammad Tarek Mansour | 117 | 1 | . . . ttcatacagaaggcgttcaagcttgtcgac |
BBa_K3244014 | IL-2 Promoter | Regulatory | Mohammad Tarek Mansour | 114 | 1 | . . . atcactactcacagtaacctcaactcctgc |
BBa_K554000 | SoxS promoter | Regulatory | UNICAMP_EMSE Brazil team | 62 | 7 | . . . atactccccaacagatgaattaacgaactg |
BBa_K554003 | SoxR | Coding | UNICAMP EMSE Brazil team | 483 | 7 | . . . cgcttgctggaagatgaacaaaactaataa |
Inflammatory
This set includes compounds and cytokines which are pro-inflammatory and Anti inflammatory (or both).
Name | Description | Type | Created by | length | uses | seq |
---|---|---|---|---|---|---|
BBa_K1228004 | A fragment of loctoferrin | Coding | Zhang SW | 75 | . . . ccgagcattacctgcgtgcgtcgcgccttt | |
BBa_K1319003 | human galectin-3, codon optimized for E. coli | Coding | Michael Osthege | 753 | . . . acctctgccagctacaccatgatctaataa | |
BBa_K1611000 | IFNgamma | Coding | Frederic Ros | 471 | . . . aggaagcggaaaaggagtcgctgctgataa | |
BBa_K1728004 | IL8 partial sequence | RNA | Yung-Li Chen, Zih-Yu Liu, Cheng-Hsiung Hsu | 102 | 1 | . . . tagggttgccagatgcaatacaagattcct |
BBa_K1728005 | IL1β partial sequence | RNA | Yung-Li Chen, Zih-Yu Liu, Cheng-Hsiung Hsu | 89 | 1 | . . . ttcttcgacacatgggataacgaggcttat |
BBa_K1929300 | Interleukin-2 (IL-2) with designed RBS | Coding | Maxwell Ng | 646 | 1 | . . . ttctgcgtttatactcgagctgcgtttata |
BBa_K223053 | hIL-6 Generator (Freiburg-compatible) | Generator | Anusuya Ramasubramanian | 620 | . . . accggttaatactagtagcggccgctgcag | |
BBa_K2520045 | Bee venom PLA epitope 1 | Protein_Domain | Dana Kadosh | 36 | 1 | . . . cactacaccgtggacaagtccaagcccaag |
BBa_K2653015 | TNF-α | Coding | Jiaxin Ma | 734 | . . . gaccaaggtggaaatcaaacgggcggccgc | |
BBa_K2817004 | Myrosinase (horseradish) | Coding | Zhaoyu Liu | 1533 | . . . aaatggttctctaaattcctggctaaataa | |
BBa_K2876014 | IL1B | Coding | Eleanor Glockner | 807 | . . . accgattttaccatgcagtttgtgagcagc | |
BBa_K2913019 | TNF-α | Coding | Yuhan Liu, Yannan Wang | 1383 | . . . acgaaaggctcagtcgaaagactgggcctt | |
BBa_K2924028 | β-casein | Coding | Melanie Sbielut, Andreas Nakielski | 702 | . . . ggatcccaccaccaccaccaccactaataa | |
BBa_K2924041 | Lactoferrin | Coding | Melanie Sbielut | 1055 | 1 | . . . tatctgacgacactgaaaaatttgcgtgaa |
BBa_K2957000 | IL-8 (CXCL8) | Coding | Cloning Team (Melody, Margaret, Krissy, Ethan) | 314 | 4 | . . . tcttgaaaagggccgaaaactcataagctt |
BBa_K2957094 | C5a | Coding | Ye Cheng Zheng | 3066 | . . . gcagaagatatcttcctgaatggatgctaa | |
BBa_K2986014 | Interleukin 10 | Coding | zheng shuxin | 534 | 1 | . . . gaagcctacatgacaatgaagatacgaaac |
BBa_K2986015 | Interleukin 8 | DNA | zheng shuxin | 297 | 1 | . . . gagaagtttttgaagagggctgagaactca |
BBa_K3009001 | FPR2 receptor | Signalling | Carolin Ruckes | 1059 | 2 | . . . gctgagacagaactccaagcgatgatcgat |
BBa_K3078005 | LL-37 | Coding | Ziang Guo | 117 | 2 | . . . cgtaatctggttccgcgtaccgaaagctaa |
BBa_K3132017 | human interleukine 15 | Coding | Qiliang Yang | 373 | . . . cacatcgtccagatgttcatcaataccagc | |
BBa_K3234000 | Human interleukin 2 | Coding | Yuxin Huang | 399 | . . . ttcgcccagagcatcatcagcacgctgacc | |
BBa_K3244015 | IL-18 | Coding | Mohammad Tarek Mansour | 579 | 1 | . . . agcatcatgttcaccgtgcagaacgaggac |
BBa_K554004 | IL10 | Coding | UNICAMP EMSE Brazil team | 504 | 1 | . . . tacatgacgatgaaaatccgtaactaataa |
Receptors
This set contains some membrane receptors.
Name | Description | Type | Created by | length | uses | seq |
---|---|---|---|---|---|---|
BBa_K1391002 | CD79A | Coding | Alexa Garcia | 684 | . . . ggagatgtccagctggagaagccgtagtag | |
BBa_K1391003 | CD79B | Coding | Alexa Garcia | 693 | . . . gtaggtgagcacccaggccaggagtagtag | |
BBa_K1993001 | CCR7 | Coding | Su Xiaojun | 1137 | . . . gccgagaccaccaccaccttctccccatag | |
BBa_K1993002 | CXCR1 | Coding | Zhou Longyuan | 1053 | . . . tcgtctgtcaatgtctcttccaacctctga | |
BBa_K1993003 | CXCR4 | Coding | Su Xiaojun | 1071 | 2 | . . . tctgagtcttcaagttttcactccagctaa |
BBa_K1993004 | CCR5 | Coding | Su Xiaojun | 1059 | . . . ggggagcaggaaatatctgtgggcttgtga | |
BBa_K1993012 | CCR2 | Coding | Su Xiaojun | 1125 | . . . gccagtcttcaggacaaagaaggagcctag | |
BBa_K1993013 | CXCR5 | Coding | Su Xiaojun | 1119 | 1 | . . . gagaatgccacctctctcaccacgttctag |
BBa_K2549001 | suface-expressed CD19 | Coding | Rongrong Du | 1083 | 1 | . . . ttgatcatgctttggcagaagaaacctaga |
BBa_K2583000 | HRH4_CDS | Coding | LiuJie | 1193 | 6 | . . . atcttcttaaaagctttggacttcttcgcc |
BBa_K2976000 | Toll-like receptor 1 | Coding | Jiatong Chen | 54 | . . . tgcggcgacgtggaggagaaccccggcccc | |
BBa_K2976001 | Toll-like receptor 1 | Coding | Jiatong Chen | 2361 | 1 | . . . attaagctgacagagcaagcaaagaaatga |
BBa_K2976002 | Toll-like receptor 2 | Coding | Jiatong Chen | 2358 | 1 | . . . aatctgagagctgcgataaagtcctgatga |
BBa_K2976003 | Cluster of differentiation 14 (CD14) | Coding | Jiatong Chen | 1128 | 1 | . . . ctgctccaaggggcccggggctttgcctaa |
BBa_K321004 | intracellular chain of KIR3DL1 | Protein_Domain | Hannah Yan | 240 | 1 | . . . aagcccagatccaaagttgtctcctgccca |
Antibodies
Antibodies are proteins used by the immune system to neutralise pathogens such as viruses and microorganisms. This set contains a few antibodies previously used.
Name | Description | Type | Created by | length | uses | seq |
---|---|---|---|---|---|---|
BBa_K1071007 | Hep B Antibody light chain | Coding | Team Marburg 2013 | 711 | . . . acaaagagcttcaaccgtggagagtgttag | |
BBa_K1071008 | Hep B Antibody heavy chain | Coding | Team Marburg 2013 | 1404 | 3 | . . . aagagcctctccctgtctccgggtaaatga |
BBa_K1391000 | Gantenerumab Variable Human Ig-M Heavy Chain | Coding | Alexa Garcia | 1860 | . . . accgtgaccctctttaaggtgaagtagtag | |
BBa_K1391001 | Gantenerumab Variable Human Ig-M Light Chain | Coding | Alexa Garcia | 720 | . . . aagagctttaacaggggggagtgctagtag | |
BBa_K1694003 | Single-chain variable fragment (Anti-VEGF) | Coding | CHIH-HSUAN HSU | 747 | 2 | . . . cagggcaccctggttaccgtgagcagttaa |
BBa_K1694004 | Single-chain variable fragment (Anti-EGFR) | Coding | CHIH-HSUAN HSU | 735 | 1 | . . . cagggcaccctggtgacagtgagtgcataa |
BBa_K1694005 | Single-chain variable fragment (Anti-HER2) | Coding | CHIH-HSUAN HSU | 582 | 2 | . . . acctctgaagattctgcggtctattactgt |
BBa_K1933004 | constitutive promoter and RBS | Regulatory | Tomoki Uchino | 60 | 6 | . . . ctagcactagagaaagaggagaaatactag |
BBa_K2247006 | Single-chain variable fragment 1 of anti-Aflatoxin B1 antibody (antiAFB1-ScFv1) | Coding | Jianing Han | 732 | 1 | . . . ggggggaccaagctggagctgaaacggtag |
BBa_K2520001 | Single Chain Fragment Variable (scFv) of rat anti-murine IgM antibody | Coding | Noa Eden, Dana Kadosh | 699 | . . . tggggccaaggagtcatggtcacagtctcc | |
BBa_K2520043 | Celiac epitope 1 | Protein_Domain | Dana Kadosh | 27 | 1 | cccttcccccagccccagctgccctac |
BBa_K2520044 | Celiac epitope 3 | Protein_Domain | Dana Kadosh | 27 | 1 | ccctacccccagccccagctgccctac |
BBa_K2622004 | scFv_antiVGY | Coding | Auksė Gaiauskaitė | 733 | . . . gcagggcacatccgtgacggtatcgtcagc | |
BBa_K2876007 | anti-aflatoxinB1 ScFv1 | Coding | Eleanor Glockner | 732 | . . . ggggggaccaagctggagctgaaacggtag | |
BBa_K2876011 | IL-1 Beta scFv2 | Coding | Eleanor Glockner | 720 | . . . ggccagggcaccctggtgaccgtgagcagc | |
BBa_K2876015 | anti-IL1B scFv1 | Coding | Eleanor Glockner | 772 | . . . cgtgagcagctaaggatcctctacgccgga | |
BBa_K2946000 | scFv (Single-Chain Variable Fragment) | Protein_Domain | eden asraf | 810 | 1 | . . . ggccaaggcacatccgtaaccgtaagctca |
BBa_K3064009 | mmuIgG-Fc | Coding | Jie Cai | 528 | 2 | . . . ctgacctgcatgataacagacttcttccct |
BBa_K3090001 | single chain variable fragment (scFv(P5)) | DNA | Jungwoo Choe | 717 | 1 | . . . ggtggtggaactaaattggagatcaagcgc |
BBa_K3090002 | single chain variable fragment (scFv(P5)) with cpp | DNA | Jungwoo Choe | 768 | . . . ggtggtggaactaaattggagatcaagcgc | |
BBa_K3117039 | kappa light chain | Protein_Domain | Lena Schorr | 321 | 2 | . . . gtaaccaaatccttcaaccgtggtgaatgc |
BBa_K3117040 | constant region 1 (CH1) of an antibody | Protein_Domain | Lena Schorr | 324 | 2 | . . . gagccgaaatcttgcgataaaactcatact |
BBa_K3132005 | anti-HER2 scFV | Coding | Qiliang Yang | 697 | . . . ggaggaggaacaaagctgacggttcttgga | |
BBa_K3346000 | Siltuximab Heavy Variable Chain for IgG | Coding | Emily Laskey | 328 | -1 | . . . gcctgtggggctattatgcgctggattatt |
BBa_T2018 | V5 epitope tag tail domain (GKPIPNPLLGLDST) | Protein_Domain | Reshma Shetty | 48 | . . . ccgctcctgggcctcgattccacgtaataa | |
BBa_T2019 | V5 epitope tag head domain (GKPIPNPLLGLDST) | Protein_Domain | Reshma Shetty | 48 | . . . ccgaacccgctcctgggcctcgattccacg | |
BBa_T2020 | V5 epitope tag special internal domain (GKPIPNPLLGLDST) | Protein_Domain | Reshma Shetty | 42 | . . . ccgaacccgctcctgggcctcgattccacg |
Others
This set contains other miscellaneous molecules whose functions are related to the immune system.
Name | Description | Type | Created by | length | uses | seq |
---|---|---|---|---|---|---|
BBa_K1686045 | crdA gene with codon optimisation for E. coli | Coding | Jean Descarpentrie | 1458 | . . . caaacgaagatttcccgtacgcagagctaa | |
BBa_K1686047 | crdC gene with codon optimisation for E. coli | Coding | Jean Descarpentrie | 1266 | . . . ggtgtatcatcaatgcatgaagctgagtaa | |
BBa_K2226003 | COX-2 gene | DNA | An-Chi Tsai | 756 | 1 | . . . aaatttttggaatgattaaatgaacaataa |
BBa_K2309021 | LL-37 for Lactococcus lactis NZ9000 (codon optimized) | Coding | Zixin Rong | 120 | 4 | . . . aaccttgttccacgtactgaatcataataa |
BBa_K2539250 | ALDH2*2 Basic Part | Coding | Catherine Chang | 1554 | 2 | . . . acagtcaaagtgcctcagaagaactcataa |
BBa_K2885000 | Protien G (ProG) | Coding | Sungho Ko | 555 | 2 | . . . gacgcgactaaaacttttaccgttaccgaa |
BBa_K2976006 | Anti-PD-L1 peptide | Coding | Jiatong Chen | 72 | 1 | . . . gtgcgccgcatcgaggacatgatgaaccag |
BBa_K380010 | Immunoglobulin G protease (IdeS) | Coding | Nina Schiller | 930 | . . . acagggcaagatagttggaatcagaccaat |
Devices
This set contains composite parts used by previous iGEM teams.
Name | Description | Type | Created by | length | uses | seq |
---|---|---|---|---|---|---|
BBa_K1598005 | pYear-RBS-TPH1-6xHis-Terminator | Composite | Marta Napiorkowska | 1611 | . . . caccttcgggtgggcctttctgcgtttata | |
BBa_K223047 | SoxR - SoxS - GFP Reporter with Lac Promoter | Reporter | Suzanne Bartram | 1867 | . . . caccttcgggtgggcctttctgcgtttata | |
BBa_K2760023 | NsrR Optimized for both L. rhamnosus GG & E.coli | Coding | iGEM18_TecMonterrey_GDL | 375 | . . . caaccgctgtacaaactgctgctggttgag | |
BBa_K2817000 | PnorV-RBS-amilCP | Composite | Zhaoyu Liu | 881 | . . . attgcacgcaaacctgtggtcgcctaataa | |
BBa_K2817007 | PyeaR-RBS-amilCP | Composite | Zhaoyu Liu | 935 | . . . caccttcgggtgggcctttctgcgtttata | |
BBa_K2967019 | The yeaR promoter will initiate the express of IL-10 when nitric oxide appear | Composite | Lijun Bao | 1130 | . . . caccttcgggtgggcctttctgcgtttata | |
BBa_K2967030 | NorR-PnorV-amplicp | Composite | Rui Wang | 2836 | . . . caccttcgggtgggcctttctgcgtttata | |
BBa_K2976014 | NF-κB induced promoter-granulysin | Composite | Jiatong Chen | 634 | . . . ttgtgtataccttctacaggtcccctctga | |
BBa_K3287000 | Nit_Blue | Composite | Maria Ancin | 935 | . . . caccttcgggtgggcctttctgcgtttata | |
BBa_K381001 | Nitrate reporter: PyeaR - GFP composite | Composite | Katharine Coyte | 986 | 3 | . . . caccttcgggtgggcctttctgcgtttata |
BBa_K554002 | HlyA secretion signal peptide | Coding | UNICAMP EMSE Brazil team | 186 | 13 | . . . tcaataaccctgaccacatcagcataataa |
BBa_K554012 | SoxS GFP HlyA device | Device | UNICAMP EMSE Brazil team | 1085 | . . . cagattattaatccggcttttttattattt |