Difference between revisions of "Collections/Immune Regulation"

Latest revision as of 15:41, 26 October 2020

The immune system requires a homeostatic balance of the components involved. It is part of the complex biological response of the body to several substances such as pathogen, antigens, allergens, etc. It is a protective mechanism that is triggered by several signals (oxidative stress, signal peptides, receptors, etc) and is regulated by the balance of pro and anti-inflammatory substances. In order to help future teams to engineer safe, effective, and required responses, we have curated the Immune regulation collection with the parts that have been designed and used by other previous teams. The collection is divided into sense and control, pro and anti-inflammatory substances, antibodies, receptors, and composite control mechanism devices to enable easy access during design. In case your iGEM team has designed a new part that involves any of these aspects, please do add on to the collection.

Sense & Control

Accidental release of inflammatory molecules can prove to be dangerous to the human body. These are parts that activate certain mechanisms like inflammatory responses only under particular conditions. eg: presence of certain pro-inflammatory compounds/molecules

*More...*
Name	Description	Type	Created by	length	uses	seq
BBa_K1799015	pYeaR	Regulatory	Will Shindel	100		. . . aatgcaaattatcaggcgtaccctgaaacg
BBa_K203111	Constitutive promoter; 2 REU	Regulatory	Lars Velten, Simon Haas, Hannah Meyer, Anne Rademacher, Hannah Uckelmann and Corinna Hiller	426		. . . gccgggatttgggtcgcggttcttgtttgt
BBa_K256004	NorR	Coding	iGEM09_NTU-Singapore	1515	6	. . . ctggcgaaacgtctgggattgaaggattaa
BBa_K2976009	NF-κB induced promoter	Regulatory	Jiatong Chen	109	2	. . . gtacggtgggaggtctatataagcagagct
BBa_K3244013	NFAT-Response Ellement	Regulatory	Mohammad Tarek Mansour	117	1	. . . ttcatacagaaggcgttcaagcttgtcgac
BBa_K3244014	IL-2 Promoter	Regulatory	Mohammad Tarek Mansour	114	1	. . . atcactactcacagtaacctcaactcctgc
BBa_K554000	SoxS promoter	Regulatory	UNICAMP_EMSE Brazil team	62	7	. . . atactccccaacagatgaattaacgaactg
BBa_K554003	SoxR	Coding	UNICAMP EMSE Brazil team	483	7	. . . cgcttgctggaagatgaacaaaactaataa

Inflammatory

This set includes compounds and cytokines which are pro-inflammatory and Anti inflammatory (or both).

*More...*
Name	Description	Type	Created by	length	uses	seq
BBa_K1228004	A fragment of loctoferrin	Coding	Zhang SW	75		. . . ccgagcattacctgcgtgcgtcgcgccttt
BBa_K1319003	human galectin-3, codon optimized for E. coli	Coding	Michael Osthege	753		. . . acctctgccagctacaccatgatctaataa
BBa_K1611000	IFNgamma	Coding	Frederic Ros	471		. . . aggaagcggaaaaggagtcgctgctgataa
BBa_K1728004	IL8 partial sequence	RNA	Yung-Li Chen, Zih-Yu Liu, Cheng-Hsiung Hsu	102	1	. . . tagggttgccagatgcaatacaagattcct
BBa_K1728005	IL1β partial sequence	RNA	Yung-Li Chen, Zih-Yu Liu, Cheng-Hsiung Hsu	89	1	. . . ttcttcgacacatgggataacgaggcttat
BBa_K1929300	Interleukin-2 (IL-2) with designed RBS	Coding	Maxwell Ng	646	1	. . . ttctgcgtttatactcgagctgcgtttata
BBa_K223053	hIL-6 Generator (Freiburg-compatible)	Generator	Anusuya Ramasubramanian	620		. . . accggttaatactagtagcggccgctgcag
BBa_K2520045	Bee venom PLA epitope 1	Protein_Domain	Dana Kadosh	36	1	. . . cactacaccgtggacaagtccaagcccaag
BBa_K2653015	TNF-α	Coding	Jiaxin Ma	734		. . . gaccaaggtggaaatcaaacgggcggccgc
BBa_K2817004	Myrosinase (horseradish)	Coding	Zhaoyu Liu	1533		. . . aaatggttctctaaattcctggctaaataa
BBa_K2876014	IL1B	Coding	Eleanor Glockner	807		. . . accgattttaccatgcagtttgtgagcagc
BBa_K2913019	TNF-α	Coding	Yuhan Liu, Yannan Wang	1383		. . . acgaaaggctcagtcgaaagactgggcctt
BBa_K2924028	β-casein	Coding	Melanie Sbielut, Andreas Nakielski	702		. . . ggatcccaccaccaccaccaccactaataa
BBa_K2924041	Lactoferrin	Coding	Melanie Sbielut	1055	1	. . . tatctgacgacactgaaaaatttgcgtgaa
BBa_K2957000	IL-8 (CXCL8)	Coding	Cloning Team (Melody, Margaret, Krissy, Ethan)	314	4	. . . tcttgaaaagggccgaaaactcataagctt
BBa_K2957094	C5a	Coding	Ye Cheng Zheng	3066		. . . gcagaagatatcttcctgaatggatgctaa
BBa_K2986014	Interleukin 10	Coding	zheng shuxin	534	1	. . . gaagcctacatgacaatgaagatacgaaac
BBa_K2986015	Interleukin 8	DNA	zheng shuxin	297	1	. . . gagaagtttttgaagagggctgagaactca
BBa_K3009001	FPR2 receptor	Signalling	Carolin Ruckes	1059	2	. . . gctgagacagaactccaagcgatgatcgat
BBa_K3078005	LL-37	Coding	Ziang Guo	117	2	. . . cgtaatctggttccgcgtaccgaaagctaa
BBa_K3132017	human interleukine 15	Coding	Qiliang Yang	373		. . . cacatcgtccagatgttcatcaataccagc
BBa_K3234000	Human interleukin 2	Coding	Yuxin Huang	399		. . . ttcgcccagagcatcatcagcacgctgacc
BBa_K3244015	IL-18	Coding	Mohammad Tarek Mansour	579	1	. . . agcatcatgttcaccgtgcagaacgaggac
BBa_K554004	IL10	Coding	UNICAMP EMSE Brazil team	504	1	. . . tacatgacgatgaaaatccgtaactaataa

Receptors

This set contains some membrane receptors.

*More...*
Name	Description	Type	Created by	length	uses	seq
BBa_K1391002	CD79A	Coding	Alexa Garcia	684		. . . ggagatgtccagctggagaagccgtagtag
BBa_K1391003	CD79B	Coding	Alexa Garcia	693		. . . gtaggtgagcacccaggccaggagtagtag
BBa_K1993001	CCR7	Coding	Su Xiaojun	1137		. . . gccgagaccaccaccaccttctccccatag
BBa_K1993002	CXCR1	Coding	Zhou Longyuan	1053		. . . tcgtctgtcaatgtctcttccaacctctga
BBa_K1993003	CXCR4	Coding	Su Xiaojun	1071	2	. . . tctgagtcttcaagttttcactccagctaa
BBa_K1993004	CCR5	Coding	Su Xiaojun	1059		. . . ggggagcaggaaatatctgtgggcttgtga
BBa_K1993012	CCR2	Coding	Su Xiaojun	1125		. . . gccagtcttcaggacaaagaaggagcctag
BBa_K1993013	CXCR5	Coding	Su Xiaojun	1119	1	. . . gagaatgccacctctctcaccacgttctag
BBa_K2549001	suface-expressed CD19	Coding	Rongrong Du	1083	1	. . . ttgatcatgctttggcagaagaaacctaga
BBa_K2583000	HRH4_CDS	Coding	LiuJie	1193	6	. . . atcttcttaaaagctttggacttcttcgcc
BBa_K2976000	Toll-like receptor 1	Coding	Jiatong Chen	54		. . . tgcggcgacgtggaggagaaccccggcccc
BBa_K2976001	Toll-like receptor 1	Coding	Jiatong Chen	2361	1	. . . attaagctgacagagcaagcaaagaaatga
BBa_K2976002	Toll-like receptor 2	Coding	Jiatong Chen	2358	1	. . . aatctgagagctgcgataaagtcctgatga
BBa_K2976003	Cluster of differentiation 14 (CD14)	Coding	Jiatong Chen	1128	1	. . . ctgctccaaggggcccggggctttgcctaa
BBa_K321004	intracellular chain of KIR3DL1	Protein_Domain	Hannah Yan	240	1	. . . aagcccagatccaaagttgtctcctgccca

Antibodies

Antibodies are proteins used by the immune system to neutralise pathogens such as viruses and microorganisms. This set contains a few antibodies previously used.

*More...*
Name	Description	Type	Created by	length	uses	seq
BBa_K1071007	Hep B Antibody light chain	Coding	Team Marburg 2013	711		. . . acaaagagcttcaaccgtggagagtgttag
BBa_K1071008	Hep B Antibody heavy chain	Coding	Team Marburg 2013	1404	3	. . . aagagcctctccctgtctccgggtaaatga
BBa_K1391000	Gantenerumab Variable Human Ig-M Heavy Chain	Coding	Alexa Garcia	1860		. . . accgtgaccctctttaaggtgaagtagtag
BBa_K1391001	Gantenerumab Variable Human Ig-M Light Chain	Coding	Alexa Garcia	720		. . . aagagctttaacaggggggagtgctagtag
BBa_K1694003	Single-chain variable fragment (Anti-VEGF)	Coding	CHIH-HSUAN HSU	747	2	. . . cagggcaccctggttaccgtgagcagttaa
BBa_K1694004	Single-chain variable fragment (Anti-EGFR)	Coding	CHIH-HSUAN HSU	735	1	. . . cagggcaccctggtgacagtgagtgcataa
BBa_K1694005	Single-chain variable fragment (Anti-HER2)	Coding	CHIH-HSUAN HSU	582	2	. . . acctctgaagattctgcggtctattactgt
BBa_K1933004	constitutive promoter and RBS	Regulatory	Tomoki Uchino	60	6	. . . ctagcactagagaaagaggagaaatactag
BBa_K2247006	Single-chain variable fragment 1 of anti-Aflatoxin B1 antibody (antiAFB1-ScFv1)	Coding	Jianing Han	732	1	. . . ggggggaccaagctggagctgaaacggtag
BBa_K2520001	Single Chain Fragment Variable (scFv) of rat anti-murine IgM antibody	Coding	Noa Eden, Dana Kadosh	699		. . . tggggccaaggagtcatggtcacagtctcc
BBa_K2520043	Celiac epitope 1	Protein_Domain	Dana Kadosh	27	1	cccttcccccagccccagctgccctac
BBa_K2520044	Celiac epitope 3	Protein_Domain	Dana Kadosh	27	1	ccctacccccagccccagctgccctac
BBa_K2622004	scFv_antiVGY	Coding	Auksė Gai�auskaitė	733		. . . gcagggcacatccgtgacggtatcgtcagc
BBa_K2876007	anti-aflatoxinB1 ScFv1	Coding	Eleanor Glockner	732		. . . ggggggaccaagctggagctgaaacggtag
BBa_K2876011	IL-1 Beta scFv2	Coding	Eleanor Glockner	720		. . . ggccagggcaccctggtgaccgtgagcagc
BBa_K2876015	anti-IL1B scFv1	Coding	Eleanor Glockner	772		. . . cgtgagcagctaaggatcctctacgccgga
BBa_K2946000	scFv (Single-Chain Variable Fragment)	Protein_Domain	eden asraf	810	1	. . . ggccaaggcacatccgtaaccgtaagctca
BBa_K3064009	mmuIgG-Fc	Coding	Jie Cai	528	2	. . . ctgacctgcatgataacagacttcttccct
BBa_K3090001	single chain variable fragment (scFv(P5))	DNA	Jungwoo Choe	717	1	. . . ggtggtggaactaaattggagatcaagcgc
BBa_K3090002	single chain variable fragment (scFv(P5)) with cpp	DNA	Jungwoo Choe	768		. . . ggtggtggaactaaattggagatcaagcgc
BBa_K3117039	kappa light chain	Protein_Domain	Lena Schorr	321	2	. . . gtaaccaaatccttcaaccgtggtgaatgc
BBa_K3117040	constant region 1 (CH1) of an antibody	Protein_Domain	Lena Schorr	324	2	. . . gagccgaaatcttgcgataaaactcatact
BBa_K3132005	anti-HER2 scFV	Coding	Qiliang Yang	697		. . . ggaggaggaacaaagctgacggttcttgga
BBa_K3346000	Siltuximab Heavy Variable Chain for IgG	Coding	Emily Laskey	328	-1	. . . gcctgtggggctattatgcgctggattatt
BBa_T2018	V5 epitope tag tail domain (GKPIPNPLLGLDST)	Protein_Domain	Reshma Shetty	48		. . . ccgctcctgggcctcgattccacgtaataa
BBa_T2019	V5 epitope tag head domain (GKPIPNPLLGLDST)	Protein_Domain	Reshma Shetty	48		. . . ccgaacccgctcctgggcctcgattccacg
BBa_T2020	V5 epitope tag special internal domain (GKPIPNPLLGLDST)	Protein_Domain	Reshma Shetty	42		. . . ccgaacccgctcctgggcctcgattccacg

Others

This set contains other miscellaneous molecules whose functions are related to the immune system.

*More...*
Name	Description	Type	Created by	length	uses	seq
BBa_K1686045	crdA gene with codon optimisation for E. coli	Coding	Jean Descarpentrie	1458		. . . caaacgaagatttcccgtacgcagagctaa
BBa_K1686047	crdC gene with codon optimisation for E. coli	Coding	Jean Descarpentrie	1266		. . . ggtgtatcatcaatgcatgaagctgagtaa
BBa_K2226003	COX-2 gene	DNA	An-Chi Tsai	756	1	. . . aaatttttggaatgattaaatgaacaataa
BBa_K2309021	LL-37 for Lactococcus lactis NZ9000 (codon optimized)	Coding	Zixin Rong	120	4	. . . aaccttgttccacgtactgaatcataataa
BBa_K2539250	ALDH2*2 Basic Part	Coding	Catherine Chang	1554	2	. . . acagtcaaagtgcctcagaagaactcataa
BBa_K2885000	Protien G (ProG)	Coding	Sungho Ko	555	2	. . . gacgcgactaaaacttttaccgttaccgaa
BBa_K2976006	Anti-PD-L1 peptide	Coding	Jiatong Chen	72	1	. . . gtgcgccgcatcgaggacatgatgaaccag
BBa_K380010	Immunoglobulin G protease (IdeS)	Coding	Nina Schiller	930		. . . acagggcaagatagttggaatcagaccaat

Devices

This set contains composite parts used by previous iGEM teams.

*More...*
Name	Description	Type	Created by	length	uses	seq
BBa_K1598005	pYear-RBS-TPH1-6xHis-Terminator	Composite	Marta Napiorkowska	1611		. . . caccttcgggtgggcctttctgcgtttata
BBa_K223047	SoxR - SoxS - GFP Reporter with Lac Promoter	Reporter	Suzanne Bartram	1867		. . . caccttcgggtgggcctttctgcgtttata
BBa_K2760023	NsrR Optimized for both L. rhamnosus GG & E.coli	Coding	iGEM18_TecMonterrey_GDL	375		. . . caaccgctgtacaaactgctgctggttgag
BBa_K2817000	PnorV-RBS-amilCP	Composite	Zhaoyu Liu	881		. . . attgcacgcaaacctgtggtcgcctaataa
BBa_K2817007	PyeaR-RBS-amilCP	Composite	Zhaoyu Liu	935		. . . caccttcgggtgggcctttctgcgtttata
BBa_K2967019	The yeaR promoter will initiate the express of IL-10 when nitric oxide appear	Composite	Lijun Bao	1130		. . . caccttcgggtgggcctttctgcgtttata
BBa_K2967030	NorR-PnorV-amplicp	Composite	Rui Wang	2836		. . . caccttcgggtgggcctttctgcgtttata
BBa_K2976014	NF-κB induced promoter-granulysin	Composite	Jiatong Chen	634		. . . ttgtgtataccttctacaggtcccctctga
BBa_K3287000	Nit_Blue	Composite	Maria Ancin	935		. . . caccttcgggtgggcctttctgcgtttata
BBa_K381001	Nitrate reporter: PyeaR - GFP composite	Composite	Katharine Coyte	986	3	. . . caccttcgggtgggcctttctgcgtttata
BBa_K554002	HlyA secretion signal peptide	Coding	UNICAMP EMSE Brazil team	186	13	. . . tcaataaccctgaccacatcagcataataa
BBa_K554012	SoxS GFP HlyA device	Device	UNICAMP EMSE Brazil team	1085		. . . cagattattaatccggcttttttattattt

@@ Line 1: / Line 1: @@
 {{Catalog/MainLinks}}
 {{TOCright}}
+The immune system requires a homeostatic balance of the components involved. It is part of the complex biological response of the body to several substances such as pathogen, antigens, allergens, etc. It is a protective mechanism that is triggered by several signals (oxidative stress, signal peptides, receptors, etc) and is regulated by the balance of pro and anti-inflammatory substances.
+In order to help future teams to engineer safe, effective, and required responses, we have curated the <b>Immune regulation</b> collection with the parts that have been designed and used by other previous teams.
+The collection is divided into sense and control, pro and anti-inflammatory substances, antibodies, receptors, and composite control mechanism devices to enable easy access during design.
+In case your iGEM team has designed a new part that involves any of these aspects, please do add on to the collection.
+===Sense & Control===
+Accidental release of inflammatory molecules can prove to be dangerous to the human body. These are parts that activate certain mechanisms like inflammatory responses only under particular conditions. eg: presence of certain pro-inflammatory compounds/molecules
+<parttable>coll_immune_regulation_sense</parttable>
 ===Inflammatory===
+This set includes compounds and cytokines which are pro-inflammatory and Anti inflammatory (or both).
 <parttable>coll_immune_regulation_inflammatory</parttable>
+===Receptors===
+This set contains some membrane receptors.
+<parttable>coll_immune_regulation_receptors</parttable>
+===Antibodies===
+Antibodies are proteins used by the immune system to neutralise pathogens such as viruses and microorganisms. This set contains a few antibodies previously used.
+<parttable>coll_immune_regulation_antibodies</parttable>
+===Others===
+This set contains other miscellaneous molecules whose functions are related to the immune system.
+<parttable>coll_immune_regulation_others</parttable>
+===Devices===
+This set contains composite parts used by previous iGEM teams.
+<parttable>coll_immune_regulation_devices</parttable>