|
|
| Line 16: |
Line 16: |
| | | | |
| | | | |
| − | ===Plasmid Design and Cloning===
| |
| | | | |
| − | <b> Plasmid Design with HSP22E and HSP22F Inserts <b>
| |
| − |
| |
| − | DNA sequences for our genes of interest (HSP22E and HSP22F) were obtained from Genbank. Gene constructs for each were designed with the following features:
| |
| − | Gibson forward and reverse overhangs - These were added onto both 5’ and 3’ ends of the gene sequences. The overhangs were complementary to the pET-19b plasmid backbone.
| |
| − | Fwd: 5’ CGGCTGCTAACAAAGCCCGA 3’
| |
| − | Rev: 5’ CTTTAAGAAGGAGATATACC 3’
| |
| − | 6x His-tag and GSG linker - The His-tag consisted of six histidines, which later allowed for protein purification using an affinity column. The GSG linker allowed for protein folding without interference by the 6xHis-tag.
| |
| − | 5’ GGCTCCGGCGGACATCATCATCATCACCATTAA 3’
| |
| − | As the HSP22 genes were obtained from eukaryotic C. reinhardtii, gene constructs were codon optimised for E. coli using the IDT Codon Optimisation Tool. DNA g-blocks were synthesised from Integrated DNA Technologies (IDT).
| |
| − |
| |
| − | Constructs were designed to be inserted into the pET-19b plasmid backbone, a standard protein expression vector. It possesses the ampicillin resistance gene to allow for selection of successfully transformed colonies. It also utilises the T7 expression system, which compliments our chosen chassis E.coli BL21 DE3. The DE3 strains carry a copy of the phage T7 RNA polymerase gene which is controlled by a lac promoter. When isopropyl β- d-1-thiogalactopyranoside (IPTG) is added, the T7 RNA Polymerase is expressed and can bind to the plasmid T7 promoter and begin the transcription of the inserted gene.
| |
| − |
| |
| − |
| |
| − | [[File:T--iGEM20 UNSW Australia--plasmid.png|500px|thumb|center|pET-19b Plasmid (5717 bp)]]
| |
| − |
| |
| − |
| |
| − | <b> Plasmid Assembly and Transformation <b>
| |
| − |
| |
| − | The two gene constructs were inserted into linearised pET-19b plasmid backbone using Gibson assembly to form two different plasmid products. Plasmids were transformed into E.coli BL-21 using the heat shock method. These were plated onto ampicillin agar plates, alongside two negative controls, and incubated overnight. HSP22E transformation plates were found to have 7 viable colonies, while HSP22F transformation plates were found to have 10 viable colonies. 5 viable colonies from each were selected, patch plates were taken and glycerol stocks were made.
| |
| − |
| |
| − | Colony PCR was performed and PCR products were visualised via DNA gel electrophoresis to identify which colonies contained the desired plasmid. Successful Gibson assembly and transformation is indicated in colony 5 (C5) for HSP22E and colonies 2-5 (C2-5) for HSP22F, seen in the bands boxed in (colour) at around 850 bp. Colonies 1 for both HSP22E and HSP22F showed slightly higher bands boxed in (colour) at around 1000 bp. These were also investigated in further steps.
| |
| − |
| |
| − |
| |
| − | [[File:T--iGEM20 UNSW Australia--gel1.png|500px|thumb|center|Figure 1: DNA gel electrophoresis showing expected PCR products with HSP22E and HSP22F inserts amplified from designed plasmid construct. Pink boxes indicate bands at the expected 850 bp size, while green boxes indicate slightly larger 1000 bp inserts, upon comparison to the 1 kb+ DNA ladder.]]
| |
| − |
| |
| − |
| |
| − | <b> Plasmid Purification and Sequencing <b>
| |
| − |
| |
| − | HSP22E Colonies 1 and 5 (C1, C5) and HSP22F Colonies 1, 2 and 4 (C1, C2, C4) were selected to verify for successful Gibson and transformation. These colonies were grown up in larger cultures overnight. Plasmids were extracted and purified using the Qiagen QiaSpin Miniprep Kit. Samples were measured on the ThermoFisher NanoDrop Spectrophotometer to identify DNA concentration and purity.
| |
| − |
| |
| − |
| |
| − | [[File:T--iGEM20 UNSW Australia--table1.png|500px|thumb|center|]]
| |
| − |
| |
| − |
| |
| − | The successful Gibson assembly and transformation was further confirmed with Sanger sequencing at the Ramaciotti Centre for Genomics (UNSW, Sydney). Both forward and reverse sequencing reactions were submitted. Sequencing results analysis using the alignment tool on Benchling indicated high sequencing homology for all colonies. Sequences were identical to the original gene construct for HSP22E C5 and HSP22F C2 and C4. HSP22E C1 and HSP22F C1 had a high level of mismatched bases compared to the original sequence and were omitted from future steps.
| |
| − |
| |
| − |
| |
| − | <b> Discussion <b>
| |
| − |
| |
| − | The cloning process was successful and recombinant E. coli containing our designed plasmid were obtained. This was verified using PCR visualisation, NanoDrop photospectrometry and Sanger sequencing. A number of controls were used throughout this to ensure that only successful transformants were identified for future steps. When transforming the cells, two negative controls were also conducted. In these, water or just plasmid backbone were added to competent cells instead of the Gibson reaction. The water only negative control plate indicated 0 colonies, confirming that colonies on other plates weren’t due to contamination. Plasmid backbone only control plates grew 6 colonies, indicating that there were background circularised plasmid present. This is likely the explanation for the multiple bands at unexpected sizes seen in the DNA gel electrophoresis (C2-4 for HSP22E).
| |
| − |
| |
| − | Additionally, when sequencing to confirm identity of the gene inserts, both a forward sequencing and reverse sequencing reaction was submitted for each colony. This ensured that sequencing errors would not affect results. This proved helpful when sequencing results for HSP22F Colony 2 (reverse primer) indicated the addition of a guanine base. However, this was not present in the forward sequencing reaction, and further inspection of the sequencing chromatogram confirmed that it was only a base calling error.
| |
| | | | |
| | | | |
