Difference between revisions of "Part:BBa K3570006"
 
(30 intermediate revisions by 2 users not shown)
Line 5: Line 5:
 
<h2>Usage</h2>
 
<h2>Usage</h2>
 
<p style="text-indent: 40px">
 
<p style="text-indent: 40px">
−
DPP1 upstream homology arm part shall be used together with DPP1 downstream homology arm part ([https://parts.igem.org/Part:BBa_K3570007 BBa_K3570007]) to target a functional yeast integration locus. When DPP1 up put to 5' of the biobrick together with DPP1 downstream to the 3', the biobrick can be integrated into the <i>S. cerevisiae's</i> genome. It will do homologous recombination within the Diacylglycerol pyrophosphate phosphatase 1 (DPP1) gene. </p>
+
DPP1 upstream homology arm part shall be used together with DPP1 downstream homology arm part ([https://parts.igem.org/Part:BBa_K3570007 BBa_K3570007]) to target a functional yeast integration locus. When DPP1 up put to 5' of the biobrick together with DPP1 downstream to the 3', the biobrick can be integrated into the <i>S. cerevisiae's</i> genome. It will target an homologous recombination within the Diacylglycerol pyrophosphate phosphatase 1 (DPP1) gene. </p>
 
<p style="text-indent: 40px">
 
<p style="text-indent: 40px">
 
This sequence was identified from a personal communication with Dr. Gilles Truan. </p>
 
This sequence was identified from a personal communication with Dr. Gilles Truan. </p>
  
 
<h2>Experiments</h2>
 
<h2>Experiments</h2>
−
<p><strong>Cloning of tHMG1 and CrtE production </strong></p>
+
<p> We used this part in the insertion of the tHMG1 and CrtE genes (part [https://parts.igem.org/Part:BBa_K3570000 BBa_K3570000]) in the yeast genome. Below is our yeast transformation protocol and our results which show that we have successfully integrated this part and that BBa_K3570006 and [https://parts.igem.org/Part:BBa_K3570007 BBa_K3570007] parts work.</p><br>
−
<li>Summary and cloning strategy:</li>
+
−
<p>The cloning strategy was to clone the blocks into two vectors before bringing them together in a unique plasmid. The blocks B14, B15 and B16 would be cloned in a pUC19 using InFusion method to form pUC19-B14B15B16. The other blocks B17, B18 and B19 would be cloned in another pUC19 using InFusion method to form pUC19-B17B18B19. pUC19-B17B18B19 would be used as a template vector to insert the sequence of B14B15B16 from pUC19-B14B15B16.</p>
+
  
−
[[File:T--Toulouse_INSA-UPS--2020_CB-F1.png|500px|thumb|center|Figure 1: Cloning strategy]]
+
<p> <strong>A. Protocols </strong></p><br>
  
−
<li>Results and discussion:</li>
+
<li><strong>Preparation of yeast competent cells</strong></li>
−
<p>Construction of pUC19-B14B15B16:</p>
+
<p>Fresh yeast were grown in 25 ml of YPD medium overnight. This preculture was diluted to low OD<sub>600 nm</sub> (e.g. 0.05) in 50 ml of fresh YPD medium. The biomass concentration was measured every two hours until it reaches an OD<sub>600 nm</sub> of around 0.8. 50 ml of culture were transfered in a 50 ml falcon-tube and were centrifuged 5 minutes at 3000 rpm at room temperature. The supernatant was removed and 25 ml of LiAc/TE was added. The tube had to be thoroughly inverted 10 times. The tube was centrifuged 5 minutes at 3000 rpm at room temperature. The supernatant was removed and 400 µl of LiAc/TE was added. The tube had to be thoroughly inverted 10 times. Yeast competent cells should be used on the same day that they have been prepared.</p><br>
−
<p>The gblocks B14, B15 and B16 have been amplified by PCR with CloneAmp HiFi PCR and then purified by NucleoSpin Gel and PCR Clean-up (Figure 17).</p>
+
  
−
[[File:T--Toulouse_INSA-UPS--2020_CB-F2.png|500px|thumb|center|Figure 2: PCR verification of the digested pUC19 and the three gblocks B14, B15 and B16 The expected strands are at 2.6kb, 0.4kb, 1.8kb and 1.0kb respectively]]
+
<li><strong>Yeast transformation</strong></li>
 +
<p>A mix in a 1.5 ml microcentrifuge tube was prepared with 2 µl of transforming DNA (BBa_K3570000), 40 µl of competent yeast cells, 25 µg of carrier DNA (SS-DNA) and 168 µl of 50% PEG in 100 mM LiAc/TE.<br>
 +
Positive control was the same mixture but the transforming DNA was replaced by 1 µL of pR313. The negative control was the same mixture but had no transforming DNA.
 +
After vortexing, the solution was incubated 45 minutes at 30°C. 13 µl of DMS0 were added and the solution was vortexed again. It was centrifuged at 10,000 rpm for 1 minute. The supernatant was removed and the pellet was resuspended in 80 µl of NaCl. The solution was seeded on YNB Petri dish with all amino acids expect histidine since histidine was our selection marker. The Petri dish was incubated at 30°C for three days.</p><br>
  
−
<p>pUC19 was digested by SbfI - BamHI and prepared to receive the PCR products B14, B15 and B16 by InFusion. After transformation of Stellar cells, selection on ampicillin, and minipreps of 8 clones, we checked the restriction profiles of the constructions. The results were then verified by digestion with the enzyme <em>Sac</em>I (Figure 18).</p>
+
<li><strong>Validation</strong></li>
 +
<p>Verification of integration of BBa_K3570000 using the DPP1 homology sequence (BBa_K3570006 and BBa_K3570007) was performed by a genomic PCR using the TaKaRa PCR amplification Kit and the following primers: primer 1 (forward) hybridizes on our selectable marker HIS3 while primer 2 (reverse) hybridizes upstream of the DPP1 gene.</p>
 +
<p> Primer 1: ATCAGGATTTGCGCCTTT</p>
 +
<p> Primer 2: GCCGCCGAGGGTATTTTACTTCCG</p><br>
  
−
      [[File:T--Toulouse_INSA-UPS--2020_CB-F2.png|500px|thumb|center|Figure 2: PCR verification of the digested pUC19 and the three gblocks B14, B15 and B16 The expected strands are at 2.6kb, 0.4kb, 1.8kb and 1.0kb respectively]]
+
<strong>B. Results and discussion</strong><br>
  
−
      [[File:T--Toulouse_INSA-UPS--2020_CB-F3.png|500px|thumb|center|Figure 3: Infusion verification: the expected sizes were 4.8kb and 1.2kb]]
+
<p>After 3 days, we were able to observe around 20 colonies in our yeast transformation, about the same amount on the positive control and none on the negative control plate. Eight clones were randomly chosen from our transformation and one from the positive control plate (figure 1) for PCR validation of the integration.</p>
  
−
<p>We had six clones that had the expected profile.Since the sequence was valid, we had successfully obtained the first plasmid of our tHmg1-CrtE construction.<br>
+
[[File:T--Toulouse_INSA-UPS--2020_CB-F7.png|500px|thumb|center|Figure 1: validation of the integration of the part BBa_K3570000 in the yeast genome using DPP1 homology sequence (BBa_3570006 and BBa_3570007). The expected correct size is 1.2kb.]]
−
Built of the pUC19-B17B18B19</p>
+
−
<p>The gblocks B17, B18 and B19 have been amplified by PCR with CloneAmp HiFi PCR and then purified by NucleoSpin Gel and PCR Clean-up (Figure 19).</p>
+
  
 +
<p>All clones have the expected size (1.2kb), and the control where we inserted pRS313 does not show any band, proving that we have successfully integrated our construction into the yeast using DPP1 homology sequence.<br>
 +
</p><br>
  
−
      [[File:T--Toulouse_INSA-UPS--2020_CB-F4.png|500px|thumb|center|Figure 4: PCR verification of the digested pUC19 and gblocks B17, B18, B19]]
 
  
−
<p>We digested the pUC19 vector by BamHI and EcoRI was done and purified the digested vector on gel. We proceeded to the InFusion reaction, transformation of Stellar cells, selection on ampicillin, and minipreps from 6 clones. The plasmids were assessed by restriction profiling with the enzymes <em>BamH</em>I and <em>EcoR</em>I.</p>
 
−
 
−
[[File:T--Toulouse_INSA-UPS--2020_CB-F5.png|500px|thumb|center|Figure 5: InFusion verification: the expected sizes were 4.8kb and 2.6kb]]
 
−
 
−
<p>Only one clone had the expected profile (figure X). We sent it to be sequenced by Eurofins and it was fortunately valid. We also had successfully obtained the second plasmid of our tHmg1-CrtE construction.</p>
 
−
<p>Built of tHmg1-CrtE:</p>
 
−
<p>The next step was to combine both plasmids by subcloning the fragment B14B15B16 into plasmid pUC19-B17B18B19.</p>
 
−
<p>To do this, we first extracted the DNA with the QIAGEN Plasmid Plus Midi Kit. Then, we digested both plasmids with SbfI and BamHI and purified with the Monarch Genomic DNA Purification Kit by NEB. The fragments were ligated together with T4 DNA ligase by NEB followed by a transformation into Stellar cells (ampicillin selection). Over the eight assessed colonies, two colonies presented the expected restriction profile when digested with <em>Sbf</em>I and <em>EcoR</em>I (Figure 21).</p>
 
−
 
−
[[File:T--Toulouse_INSA-UPS--2020_CB-F6.png|500px|thumb|center|Figure 6: Ligation verification: the expected size is 6.6kb and 2.6kb.]]
 
−
 
−
<li>Yeast transformation:</li>
 
−
 
−
<p>Since the construction was successful, we proceeded to the next step. We followed the protocol given by one of our advisors, Anthony Henras, in order to get competent yeast cells for the transformation. The plasmid was digested with enzymes <em>Sbf</em>I and <em>EcoR</em>I and purified to transform the yeast Saccharomyces cerevisiae. The yeast was then grown on YNB HIS- for 3 days. At the third try, we were able to observe around 20 colonies in our yeast transformation, about the same on the positive control and none on the negative control plate.</p>
 
−
<p>To verify our colonies we performed a genomic PCR using the TaKaRa PCR Amplification Kit, so we randomly chose eight clones from our transformation and one from the positive control plate (Figure 22).</p>
 
−
 
−
[[File:T--Toulouse_INSA-UPS--2020_CB-F7.png|500px|thumb|center|Figure 7: Transformation verification: the expected size is 1.2kb.]]
 
−
 
−
<p>All clones have the expected size (1.2kb), and the control where we inserted pRS313 does not show any band. We have successfully integrated tHmg1 and CrtE into the yeast!</p>
 
  
 
<h2>References</h2>
 
<h2>References</h2>

Latest revision as of 12:10, 26 October 2020


DPP1 upstream homologous sequence

Usage

DPP1 upstream homology arm part shall be used together with DPP1 downstream homology arm part (BBa_K3570007) to target a functional yeast integration locus. When DPP1 up put to 5' of the biobrick together with DPP1 downstream to the 3', the biobrick can be integrated into the S. cerevisiae's genome. It will target an homologous recombination within the Diacylglycerol pyrophosphate phosphatase 1 (DPP1) gene.

This sequence was identified from a personal communication with Dr. Gilles Truan.

Experiments

We used this part in the insertion of the tHMG1 and CrtE genes (part BBa_K3570000) in the yeast genome. Below is our yeast transformation protocol and our results which show that we have successfully integrated this part and that BBa_K3570006 and BBa_K3570007 parts work.


A. Protocols


  • Preparation of yeast competent cells

    • Fresh yeast were grown in 25 ml of YPD medium overnight. This preculture was diluted to low OD600 nm (e.g. 0.05) in 50 ml of fresh YPD medium. The biomass concentration was measured every two hours until it reaches an OD600 nm of around 0.8. 50 ml of culture were transfered in a 50 ml falcon-tube and were centrifuged 5 minutes at 3000 rpm at room temperature. The supernatant was removed and 25 ml of LiAc/TE was added. The tube had to be thoroughly inverted 10 times. The tube was centrifuged 5 minutes at 3000 rpm at room temperature. The supernatant was removed and 400 µl of LiAc/TE was added. The tube had to be thoroughly inverted 10 times. Yeast competent cells should be used on the same day that they have been prepared.


  • Yeast transformation

    • A mix in a 1.5 ml microcentrifuge tube was prepared with 2 µl of transforming DNA (BBa_K3570000), 40 µl of competent yeast cells, 25 µg of carrier DNA (SS-DNA) and 168 µl of 50% PEG in 100 mM LiAc/TE.
    Positive control was the same mixture but the transforming DNA was replaced by 1 µL of pR313. The negative control was the same mixture but had no transforming DNA. After vortexing, the solution was incubated 45 minutes at 30°C. 13 µl of DMS0 were added and the solution was vortexed again. It was centrifuged at 10,000 rpm for 1 minute. The supernatant was removed and the pellet was resuspended in 80 µl of NaCl. The solution was seeded on YNB Petri dish with all amino acids expect histidine since histidine was our selection marker. The Petri dish was incubated at 30°C for three days.


  • Validation

    • Verification of integration of BBa_K3570000 using the DPP1 homology sequence (BBa_K3570006 and BBa_K3570007) was performed by a genomic PCR using the TaKaRa PCR amplification Kit and the following primers: primer 1 (forward) hybridizes on our selectable marker HIS3 while primer 2 (reverse) hybridizes upstream of the DPP1 gene.

    Primer 1: ATCAGGATTTGCGCCTTT

    Primer 2: GCCGCCGAGGGTATTTTACTTCCG


    B. Results and discussion

    After 3 days, we were able to observe around 20 colonies in our yeast transformation, about the same amount on the positive control and none on the negative control plate. Eight clones were randomly chosen from our transformation and one from the positive control plate (figure 1) for PCR validation of the integration.

    Figure 1: validation of the integration of the part BBa_K3570000 in the yeast genome using DPP1 homology sequence (BBa_3570006 and BBa_3570007). The expected correct size is 1.2kb.

    All clones have the expected size (1.2kb), and the control where we inserted pRS313 does not show any band, proving that we have successfully integrated our construction into the yeast using DPP1 homology sequence.



    References

    • S. cerevisiae genome, chromosome IV, DPP1 gene. GenBank: CP046084.1

    Sequence and Features


    Assembly Compatibility:
    • 10
      INCOMPATIBLE WITH RFC[10]
      Illegal PstI site found at 50
    • 12
      INCOMPATIBLE WITH RFC[12]
      Illegal PstI site found at 50
    • 21
      COMPATIBLE WITH RFC[21]
    • 23
      INCOMPATIBLE WITH RFC[23]
      Illegal PstI site found at 50
    • 25
      INCOMPATIBLE WITH RFC[25]
      Illegal PstI site found at 50
    • 1000
      COMPATIBLE WITH RFC[1000]