Difference between revisions of "Part:BBa K3652002"

Revision as of 23:31, 25 October 2020

sFlt1-14 shRNA 2 (pLKO-tet-neo)

This DNA oligo is the cDNA template (5’ gtctcaaaaaacaaataaataaaaagttctcttttatttatttgttttttgagac 3’) for the shRNA designed to bind to and degrade sFlt1-14 mRNA in human endothelial cells. It can be inserted between any restriction site(s) with the proper prefix and suffix. When coded, this cDNA produces a shRNA sequence that will be manipulated by the Dicer enzyme in humans to produce siRNA and form a RISC complex that can degrade the mRNA of protein sFlt1-14, which is overproduced in the placentas of preeclamptic patients, and preventing its overexpression [1]. The target site on the sFlt1-14 mRNA is at position 2603-2626.

1. Usage

This shRNA sequence would be used to silence the expression of sFlt1-14 in the human placenta. It can be delivered in several different ways, including through a viral vector, transkingdom (E. coli/bacterial) deliver system, or via synthetic nanoparticles such as lipid packaging systems.

2. Biology

Eukaryotic organisms contain an RNAi mechanism for sequence-specific gene silencing that is triggered by the introduction of double-stranded RNA (dsRNA). Once introduced into the cell, the dsRNA or shRNA is cleaved into small interfering RNA (siRNA) by an enzyme called Dicer, producing two siRNAs, a sense strand, and an antisense strand. Each siRNA strand is loaded into Argonaute, an endonuclease, to form an RNA-induced Silencing Complex (RISC), and guiding the RISC to the target mRNA, resulting in the effective cleavage and subsequent degradation of the target mRNA. RNAi mechanisms can be triggered by introducing dsRNA, siRNA or shRNA, and sometimes miRNA as well.

3. Characterization

3.1 Design of GLS-shRNA-1

This part was synthesized as a shRNA (small hairpin RNA) sequence for the mRNA sequence of sFlt1-14 [2], a protein that plays a major role in the molecular mechanisms of preeclampsia [1]. sFlt1-14 (soluble Fms-like tyrosine kinase 1-14) is an antiangiogenic receptor that binds with PlGF (Placental Growth Factor) and VEGF (Vascular Endothelial Growth Factor), preventing them from binding to their proper receptors that signal for angiogenesis in the placenta. This shRNA cDNA can be expressed in any vector that is safe to use in vivo for human/mammalian RNAi (RNA interference).

The shRNA was developed as a region complementary to the mRNA of the sFlt1-14, and with several other parameters in mind, described below in design considerations.

This novel part was synthesized using siRNA design software, corroborated from several sources including the InvivoGen siRNA wizard [3], the Horizon Discovery siDESIGN tool [4], the GenScript siRNA Design Center [5], the Stanford Design Center [6], and the Thermo Fischer BLOCK-iT™ RNAi Designer software [7].

After cross-checking various siRNA recommended by the InvivoGen, Horizon, GenScript, Stanford Design, and Thermo Fisher software algorithms, the following general shRNA design guidelines from InvivoGen [8] were taken into consideration to attain this specific shRNA sequence:

Target site:
Not being in the first 100 bases from the start codon or within 100 bases from the stop codon
Not being in the intron

Nucleotide content of siRNA:
The first nucleotide of the siRNA coding sequence can either be an A or a G
(Generally A, but can be G if using an H1 promoter)
GC content of ~35-50% GC content
UU overhangs in 3′-end (increase siRNA stability)
siRNA should be < 30 nt to avoid nonspecific silencing

Loop:
Loops of 5, 7 or 9 nt. are similarly effective in testing
Loop used in this case was 9 nt UUCAAGAGA

3.2 shRNA Subcloning

Resuspend each target oligonucleotide in ddH2O to a concentration of 100 µM.
Mix the sense and antisense oligos at a 1:1 ratio, resulting in 50 µM of ds oligo (assuming 100% annealing efficiency).
1. Using a PCR thermocycler, perform oligo annealing at:

72 ℃ for 2 minutes

37 ℃ for 2 minutes

25 ℃ for 2 minutes

2. Set up the ligation reaction:

Bbs I linearized vector at 4 µl

Annealed oligonucleotides at 3 µl

5x DNA Ligase Buffer at 2 µl

T4 DNA Ligase at 1 µl

Total volume should be 10 µl

3. Mix gently by pipetting up and down, followed by incubation at room temperature (25 ℃) for 1-2 hours.

After this, a gel electrophoresis would be needed to verify the transcription, and the resulting length should be 55 nucleotides, as that is the length of the annealed shRNA oligo template.

3.4 RNAi efficiency test

To verify the success of the RNA degradation, the protein sFtl1-14 can be quantified through western blot and control and shRNA samples can be compared by measured protein levels. The sample of shRNA-treated cells should have lower levels of sFlt1-14 if the knockdown was effective.

However, if the gel electrophoresis showed successful shRNA transcription, and the western blotting does not show evidence of successful RNAi treatment, a qRT-PCR analysis should be performed with controls and shRNA samples to measure relative levels of the RNA remaining in each sample type. Here, one could expect to see lower levels of the sFlt1-14 RNA in treated samples compared to control samples. This would imply that more time was needed for the protein knockdown, and this timing discrepancy can provide a rough indication of how long protein knockdown would take after RNAi is achieved in target cells.

In the case that even RNA knockdown is not observed through the qRT-PCR, targeting a different section of the mRNA to prevent off-target binding which might be occurring, or introducing a combination of shRNAs to target multiple sites at once to increase binding probability, might be helpful.

Plasmid map of tet-pLKO-neo with the shRNA insert

Pathway to shRNA expression using the tet-pLKO-neo cloning plasmid

3.5 Example Plasmid Insertion (tet-pLKO-neo)

As previously stated, one example of a vector that could be used for the delivery and expression of this shRNA is the lentiviral vector, with tet-on cloning plasmid tet-pLKO-neo. The operation with this system is shown in the diagrams to the right.

4. References

[1] Roberts, J., & Rajakumar, A. (2009, July). Preeclampsia and soluble fms-like tyrosine kinase 1. Retrieved October 23, 2020, from https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2708948/
[2] Sela, S. (2007, December 30). Homo sapiens soluble VEGF receptor 1-14 (FLT1) mRNA, complete cds - Nucleotide - NCBI. Retrieved October 23, 2020, from https://www.ncbi.nlm.nih.gov/nuccore/EU368830.1?report=fasta
[3] Find siRNA sequences - Standard search. (n.d.). Retrieved October 23, 2020, from https://www.invivogen.com/sirnawizard/design.php
[4] (n.d.). Retrieved October 23, 2020, from https://horizondiscovery.com/en/products/tools/siDESIGN-Center [5] GenScript siRNA Target Finder. (n.d.). Retrieved October 23, 2020, from https://www.genscript.com/tools/sirna-target-finder
[6] (n.d.). Retrieved October 23, 2020, from https://rnaidesigner.thermofisher.com/rnaiexpress/
[7] Kay Lab siRNA/shRNA/Oligo Optimal Design. (n.d.). Retrieved October 23, 2020, from http://web.stanford.edu/group/markkaylab/cgi-bin/
[8] SiRNA and shRNA Design Guidelines. (2019, November 26). Retrieved October 23, 2020, from https://www.invivogen.com/review-sirna-shrna-design
[9] Li, L., Lin, X., Khvorova, A., Fesik, S., & Shen, Y. (2013, October). Defining the optimal parameters for hairpin-based knockdown constructs. Retrieved October 23, 2020, from https://www.ncbi.nlm.nih.gov/pmc/articles/PMC1986814/

Sequence and Features