Difference between revisions of "Part:BBa K3458005"
ShuangMiao (Talk | contribs) |
ShuangMiao (Talk | contribs) |
||
Line 1: | Line 1: | ||
− | |||
__NOTOC__ | __NOTOC__ | ||
<partinfo>BBa_K3458005 short</partinfo> | <partinfo>BBa_K3458005 short</partinfo> | ||
− | + | This part is improvement of[https://parts.igem.org/Part:BBa_K1763000 BBa_K1763000], to let''Apis Mellifera''Silk Fibroin 3 express in''Arabidopsis thaliana'' better. | |
<!-- Add more about the biology of this part here --> | <!-- Add more about the biology of this part here --> | ||
===Usage and Biology=== | ===Usage and Biology=== | ||
+ | '''According to the codon preference of ''Arabidopsis thaliana'', our team optimized the codon of [https://parts.igem.org/Part:BBa_K1763000 BBa_K1763000] to make it more suitable for expression in plants, providing a basis for subsequent research on this part in plants.''' | ||
+ | |||
+ | ''The following is an introduction to the biological background of the original part. If you need more information, please pay attention to the team 2015 UCLA’s project.'' | ||
+ | |||
+ | Silk from ''Apis Mellifera represents an intriguing alternative to silks from spiders or silkworms. Although it is not quite as strong as these other types of silks, working with honey bee silk has certain advantages over spider and silkworm silk (Weisman). The size of the honey bee silk protein gene is considerably smaller than the silk genes of spiders or silkworms. More importantly, the gene sequence is non repetitive, which allows us to synthesize and make modifications to the gene without the complications that are inherent to repetitive DNA sequences. Honey bee silk also has a very different secondary and tertiary structure than spider and silkworm silks. It forms primary alpha helices, and four silk proteins come together to form a coiled coil structure these coiled coils are formed from four similar, yet unique proteins, Amelf 1-4 (Sutherland 2007). However, a study has shown that using one of these proteins, (Amelf3) is sufficient to reproduce the physical properties of the wild type fibers (Sutherland). | ||
+ | (quoted from [https://parts.igem.org/wiki/index.php?title=Part:BBa_K1763000]) | ||
+ | |||
<!-- --> | <!-- --> | ||
Line 12: | Line 18: | ||
<partinfo>BBa_K3458005 SequenceAndFeatures</partinfo> | <partinfo>BBa_K3458005 SequenceAndFeatures</partinfo> | ||
+ | ATGGGAGTTGAAGAATTTAAGAGCAGCGCTACGGAAGAGGTTATTTCTAAGAATCTTGAGGTTGACTTGTTGAAGAACGTGGACACGAGCGCTAAGAGGAGGGAAAATGGAGCACCAGTGTTGGGGAAGAATACTTTGCAAAGTCTTGAAAAGATCAAGACAAGTGCATCAGTGAATGCTAAGGCTGCTGCTGTGGTTAAGGCTTCAGCTTTGGCATTGGCTGAAGCTTATCTTAGAGCTAGTGCTTTGTCTGCTGCTGCATCTGCTAAGGCTGCTGCTGCTCTTAAGAATGCTCAACAAGCTCAACTTAATGCTCAAGAGAAGTCTCTTGCTGCTCTTAAAGCTCAATCTGAAGAAGAAGCTGCTTCAGCTAGAGCTAATGCTGCTACTGCTGCTACTCAATCAGCCCTTGAAAGAGCTCAAGCAAGCTCTAGGTTGGCAACTGTTGCTCAAAATGTGGCTTCTGATTTGCAAAAGAGAACTTCTACTAAGGCTGCCGCTGAAGCCGCTGCTACTCTCAGGCAACTTCAAGACGCTGAAAGAACAAAGTGGAGTGCTAATGCTGCATTAGAAGTGAGTGCTGCTGCTGCTGCTGCTGAAACTAAAACAACTGCTTCTTCTGAAGCTGCTAACGCTGCTGCTAAAAAGGCTGCTGCTATAGCTTCTGATGCTGATGGAGCTGAAAGGTCTGCTTCAACTGAAGCTCAATCTGCTGCTAAAATCGAATCCGTGGCTGCCGCTGAAGGTAGCGCTAATAGTGCATCAGAAGATTCTAGGGCTGCCCAATTAGAAGCATCTACTGCTGCTAGAGCTAACGTGGCTGCTGCTGTTGGAGATGGGGCTATTATAGGACTTGGAGAAGAAGCTGGAGCTGCTGCTCAATTGCTTGCCCAAGCTAAGGCTCTTGCTGAAGTTTCTTCTAAGAGTGAAAACATTGAAGATAAGAAGTTC | ||
<!-- Uncomment this to enable Functional Parameter display --> | <!-- Uncomment this to enable Functional Parameter display --> |
Revision as of 08:14, 24 October 2020
Apis Mellifera Silk Fibroin 3 With Codon Optimization
This part is improvement ofBBa_K1763000, to letApis MelliferaSilk Fibroin 3 express inArabidopsis thaliana better.
Usage and Biology
According to the codon preference of Arabidopsis thaliana, our team optimized the codon of BBa_K1763000 to make it more suitable for expression in plants, providing a basis for subsequent research on this part in plants.
The following is an introduction to the biological background of the original part. If you need more information, please pay attention to the team 2015 UCLA’s project.
Silk from Apis Mellifera represents an intriguing alternative to silks from spiders or silkworms. Although it is not quite as strong as these other types of silks, working with honey bee silk has certain advantages over spider and silkworm silk (Weisman). The size of the honey bee silk protein gene is considerably smaller than the silk genes of spiders or silkworms. More importantly, the gene sequence is non repetitive, which allows us to synthesize and make modifications to the gene without the complications that are inherent to repetitive DNA sequences. Honey bee silk also has a very different secondary and tertiary structure than spider and silkworm silks. It forms primary alpha helices, and four silk proteins come together to form a coiled coil structure these coiled coils are formed from four similar, yet unique proteins, Amelf 1-4 (Sutherland 2007). However, a study has shown that using one of these proteins, (Amelf3) is sufficient to reproduce the physical properties of the wild type fibers (Sutherland). (quoted from [1])
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]
ATGGGAGTTGAAGAATTTAAGAGCAGCGCTACGGAAGAGGTTATTTCTAAGAATCTTGAGGTTGACTTGTTGAAGAACGTGGACACGAGCGCTAAGAGGAGGGAAAATGGAGCACCAGTGTTGGGGAAGAATACTTTGCAAAGTCTTGAAAAGATCAAGACAAGTGCATCAGTGAATGCTAAGGCTGCTGCTGTGGTTAAGGCTTCAGCTTTGGCATTGGCTGAAGCTTATCTTAGAGCTAGTGCTTTGTCTGCTGCTGCATCTGCTAAGGCTGCTGCTGCTCTTAAGAATGCTCAACAAGCTCAACTTAATGCTCAAGAGAAGTCTCTTGCTGCTCTTAAAGCTCAATCTGAAGAAGAAGCTGCTTCAGCTAGAGCTAATGCTGCTACTGCTGCTACTCAATCAGCCCTTGAAAGAGCTCAAGCAAGCTCTAGGTTGGCAACTGTTGCTCAAAATGTGGCTTCTGATTTGCAAAAGAGAACTTCTACTAAGGCTGCCGCTGAAGCCGCTGCTACTCTCAGGCAACTTCAAGACGCTGAAAGAACAAAGTGGAGTGCTAATGCTGCATTAGAAGTGAGTGCTGCTGCTGCTGCTGCTGAAACTAAAACAACTGCTTCTTCTGAAGCTGCTAACGCTGCTGCTAAAAAGGCTGCTGCTATAGCTTCTGATGCTGATGGAGCTGAAAGGTCTGCTTCAACTGAAGCTCAATCTGCTGCTAAAATCGAATCCGTGGCTGCCGCTGAAGGTAGCGCTAATAGTGCATCAGAAGATTCTAGGGCTGCCCAATTAGAAGCATCTACTGCTGCTAGAGCTAACGTGGCTGCTGCTGTTGGAGATGGGGCTATTATAGGACTTGGAGAAGAAGCTGGAGCTGCTGCTCAATTGCTTGCCCAAGCTAAGGCTCTTGCTGAAGTTTCTTCTAAGAGTGAAAACATTGAAGATAAGAAGTTC