Difference between revisions of "Part:BBa K3652001"

Revision as of 01:47, 24 October 2020

sFlt1-14 shRNA (pLKO-tet-neo)

This DNA oligo is the cDNA template (5’ GTCATCATCATCATCATCATAAAGTTCTCTTATGATGATGATGATGATGAC 3’) for the shRNA designed to bind to and degrade sFlt1-14 mRNA in human endothelial cells. It can be inserted between any restriction site(s) with the proper prefix and suffix. When coded, this cDNA produces a shRNA sequence that will be manipulated by the Dicer enzyme in humans to produce siRNA and form a RISC complex that can degrade the mRNA of protein sFlt1-14, which is overproduced in the placentas of preeclamptic patients, and preventing its overexpression [1]. The target site on the sFlt1-14 mRNA is at position 2603-2626.

1. Usage

This shRNA sequence would be used to silence the expression of sFlt1-14 in the human placenta. It can be delivered in several different ways, including through a viral vector, transkingdom (E. coli/bacterial) deliver system, or via synthetic nanoparticles such as lipid packaging systems.

2. Biology

Eukaryotic organisms contain an RNAi mechanism for sequence-specific gene silencing that is triggered by the introduction of double-stranded RNA (dsRNA). Once introduced into the cell, the dsRNA or shRNA is cleaved into small interfering RNA (siRNA) by an enzyme called Dicer, producing two siRNAs, a sense strand, and an antisense strand. Each siRNA strand is loaded into Argonaute, an endonuclease, to form an RNA-induced Silencing Complex (RISC), and guiding the RISC to the target mRNA, resulting in the effective cleavage and subsequent degradation of the target mRNA. RNAi mechanisms can be triggered by introducing dsRNA, siRNA or shRNA, and sometimes miRNA as well.

3. Characterization

3.1 Design of GLS-shRNA-1

This part was synthesized as a shRNA (small hairpin RNA) sequence for the mRNA sequence of sFlt1-14 [2], a protein that plays a major role in the molecular mechanisms of preeclampsia [1]. sFlt1-14 (soluble Fms-like tyrosine kinase 1-14) is an antiangiogenic receptor that binds with PlGF (Placental Growth Factor) and VEGF (Vascular Endothelial Growth Factor), preventing them from binding to their proper receptors that signal for angiogenesis in the placenta. This shRNA cDNA can be expressed in any vector that is safe to use in vivo for human/mammalian RNAi (RNA interference).

The shRNA was developed as a region complementary to the mRNA of the sFlt1-14, and with several other parameters in mind, described below in design considerations.

This novel part was synthesized using siRNA design software, corroborated from several sources including the InvivoGen siRNA wizard [3], the Horizon Discovery siDESIGN tool [4], the GenScript siRNA Design Center [5], the Stanford Design Center [6], and the Thermo Fischer BLOCK-iT™ RNAi Designer software [7].

After cross-checking various siRNA recommended by the InvivoGen, Horizon, GenScript, Stanford Design, and Thermo Fisher software algorithms, the following general shRNA design guidelines from InvivoGen [8] were taken into consideration to attain this specific shRNA sequence:

Target site:
Not being in the first 100 bases from the start codon or within 100 bases from the stop codon
Not being in the intron

Nucleotide content of siRNA:
The first nucleotide of the siRNA coding sequence can either be an A or a G
(Generally A, but can be G if using an H1 promoter)
GC content of ~35-50% GC content
UU overhangs in 3′-end (increase siRNA stability)
siRNA should be < 30 nt to avoid nonspecific silencing

Loop:
Loops of 5, 7 or 9 nt. are similarly effective in testing

Table 1. Characteristics of sFlt1-14 shRNA 1

Characteristic	sFlt1-14-shRNA-1
Sequence
GC% of antisense strand	52
GC% at 5′-end of antisense strand	48
GC% at 3′-end of antisense strand	56
Target site	231-251 after AUG

3.2 shRNA Subcloning

Resuspend each target oligonucleotide in ddH2O to a concentration of 100 µM. Mix the sense and antisense oligos at a 1:1 ratio, resulting in 50 µM of ds oligo (assuming 100% annealing efficiency). Using a PCR thermocycler, perform oligo annealing at: 72 ℃ for 2 minutes 37 ℃ for 2 minutes 25 ℃ for 2 minutes Set up the ligation reaction: Bbs I linearized vector at 4 µl Annealed oligonucleotides at 3 µl 5x DNA Ligase Buffer at 2 µl T4 DNA Ligase at 1 µl Total volume should be 10 µl Mix gently by pipetting up and down, followed by incubation at room temperature (25 ℃) for 1-2 hours.

After this, a gel electrophoresis would be needed to verify the transcription, and the resulting length should be 55 nucleotides, as that is the length of the annealed shRNA oligo template.

Fig. 2. Diagram illustrating the procedure of GLS-shRNA-1 in vitro transcription

The integrity of ALR-shRNA-1 was identified through 3% agarose gel eletrophoresis (Fig. 3) Agarose gel electrophoresis showed that the ALR-shRNA-1 was successfully transcribed. Sharp bands of around 52 bases in length were detected on the gel, the size of the bands is correct.

Fig 3. Detection of in vitro transcribed GLS-shRNA-1 by agarose gel (3%). The integrity of shRNA was identified through 3% agarose gel eletrophoresis (200 V, 30 min).

3.4 RNAi efficiency test

Adult P. striolata were obtained from Shenzhen University field station, and kept in glass bottles. The tissue culture seedlings of Chinese cabbage, Brassica chinensis leaves were placed into the above bottles (Fig. 4).

Fig.4. Adult P. striolata and Brassica chinensis leaves were placed into the glass bottles for RNAi efficiency test. GLS-shRNA-1 sample has two repeats.

The solutions of GLS-shRNA-1 (10 ng/mL) was sprayed onto the leaves of Chinese cabbage every third day, each solution has two repeats. Around twenty adult beetles of P. striolata were tested per siRNA/shRNA sample. The survival rates of adult beetles, were recorded at different days after GLS-shRNA-1 treatment.

Results show that, GLS-shRNA-1 could trigger RNAi mechanism, which was demonstrated by the significant survival rate decrease after treatment, while the negative control sample showed slight survival rate decrease.

Fig. 5 The survival rate of Phyllotreta striolata at different days after GLS-shRNA-1 treatment.

4. References

[1] Baum J.A., Bogaert T., Clinton W., Heck G.R., Feldmann P., Ilagen O., Johnson S., Plaetinck G., Munyikwa T., Pleau M., Vaughn T., Roberts J. 2007: Control of coleopteran insect pests through RNA interference. Nat. Biotech. 25: 1322–1326.
[2] Gorden K.H. & Waterhouse P.M. 2007: RNAi for insect-proof plants. Nat. Biotech.25: 1231–1232.
[3] Macrae I.J., Zhou K., Li F., Repic A., Brooks A.N., Cande W.Z., Adams P.D., Doudna J.A. 2006: Structural basis for double-stranded RNA processing by Dicer. Science. 311 (5758): 195–8.
[4] Mao Y.B., CAI W.J., WANG J.W., HONG G.J., TAO X.Y., WANG L.J., HUANG Y.P., CHEN X.Y. 2007: Silencing a cotton bollworm P450 monooxygenase gene by plant-mediated RNAi impairs larval tolerance of gossypol. Nat. Biotech. 25: 1307–1313.
[5] Turner C.T., Davy M.W., Macdiarmid R.M., Plummer K.M., Birch N.P., Newcomb R.D. 2006: RNA interference in the light brown apple moth, Epiphyas postvittana (Walker) induced by double-stranded RNA feeding. Insect Mol. Biol. 15: 383–391.
[6] Wang M, Weiberg A, Lin F M, et al. Bidirectional cross-kingdom RNAi and fungal uptake of external RNAs confer plant protection[J]. Nature Plants, 2016, 2(10):16151-16151.
[7] Zhao Y.Y., Yang G., Pruski W., You M.S. 2008: Phyllotreta striolata (Coleoptera: Chrysomelidae): arginine kinase cloning and RNAi-based pest control. Eur J Entomol 105: 815–822. Sequence and Features