Difference between revisions of "Part:BBa K3090001"
(→‎MIT MAHE 2020)
 
(2 intermediate revisions by 2 users not shown)
Line 18: Line 18:
  
 
The DNA for scFv(P5) with N-terminal His6-tag was designed with codon optimization for E.coli expression.
 
The DNA for scFv(P5) with N-terminal His6-tag was designed with codon optimization for E.coli expression.
 +
[[image:BBa_K3090001_0.png|500px]]
  
−
CAGGTACAATTGCAAGAGTCCGGGGGTGACCTGGTTCAGCCCGGCGGCAGTTTGAAGTTGTCATGCGCTGTTTCTGGGTTTTCATTAACGGGATACGGAGTAAACTGGGTTCGCCAAACACCGGACAAACGTCTTGAATGGGTGGCAATGATTTGGGGTGATGGGAACACCGACTACAACTCGTCAGTCAAAGGGCGCTTCACGATCAGCAAGGACAACGCTAAGTCAACGGTATACTTGCAAATGTCTAGTCTGAAGAGCGAAGACACAGCTATGTATTATTGTGCACGCGAGCGCGATTATCGTTTAGACTATTGGGGACAAGGAACGACAGTTACAGTTAGTAGCGGGGGCGGGGGCTCAGGAGGTGGGGGTTCTGGTGGAGGTGGCTCGGATATCGAACTGACACAAAGCCCTGCATCGTTGGCTGTCAGCTTGGGGCAACGTGCAACAATTAGCTGTCGCGCTTCAGGTAACATTCATAATTATTTGGCGTGGTATCAACAGAAGCCGGGGCAACCTCCCAAGCTTCTTATCTACTACACTACAACTCTGGCGGATGGGATTCCTGCCCGTTTCAGCGGTTCAGGTTCGGGTACGGATTATACTCTGACTATTAATCCAGTGGAAGCGGATGATGTCGCCACTTATTACTGCCAGCATTTTTGGAGTACGCCACGCACTTTCGGTGGTGGAACTAAATTGGAGATCAAGCGC
+
==MIT_MAHE 2020==
 +
'''Summary'''
  
 +
Chimeric molecule in which several groups of residues important for antigen binding in the poorly stable anti-hen egg lysozyme (HEL). The scFv(F8), deriving from a monoclonal antibody raised against the coat protein of the plant virus AMCV, has been expressed as a functional molecule in the cytoplasm of Escherichia coli, yeast,and plants. Denaturation/renaturation studies indicate that this molecule has high in vitro stability and is capable of refolding to a functional form under reducing conditions.
  
−
 
+
==References==
−
=== References ===
+
 
1. Tavladoraki, P., Benvenuto, E., Trinca, S., De Martinis, D., Cattaneo, A. & Galeffi, P. (1993). Transgenic plants expressing a functional single-chain Fv antibody are specifically protected from virus attack. Nature, 366, 469–472.
 
1. Tavladoraki, P., Benvenuto, E., Trinca, S., De Martinis, D., Cattaneo, A. & Galeffi, P. (1993). Transgenic plants expressing a functional single-chain Fv antibody are specifically protected from virus attack. Nature, 366, 469–472.
  

Latest revision as of 18:27, 23 October 2020


single chain variable fragment (scFv(P5))

scFv(P5) is chimeric molecule in which several groups of residues important for antigen binding in the poorly stable anti-hen egg lysozyme (HEL) scFv(D1.3) were progressively grafted onto the scFv(F8) scaffoldis to maintain cytoplasmic stability and specificity.

Usage and Biology

Only a few antibodies have proved to possess naturally both high in vitro thermodynamic stability and the capacity to be functionally expressed in the cytosol milieu. Among these, the scFv(F8), deriving from a monoclonal antibody raised against the coat protein of the plant virus AMCV, has been expressed as a functional molecule in the cytoplasm of Escherichia coli, yeast,and plants. Denaturation/renaturation studies indicate that this molecule has high in vitro stability and is capable of refolding to a functional form under reducing conditions. Based on the scFv(F8) scaffold, antigen binding residues in the complementarity determining regions (CDRs) of anti-hen egg white lysozyme (HEL) D1.3 monoclonal antibody was grafted to scFv(F8) to make this part "scFv(F8)".

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Illegal SapI.rc site found at 255


Characterization

protein-NA-

The DNA for scFv(P5) with N-terminal His6-tag was designed with codon optimization for E.coli expression. BBa K3090001 0.png

MIT_MAHE 2020

Summary

Chimeric molecule in which several groups of residues important for antigen binding in the poorly stable anti-hen egg lysozyme (HEL). The scFv(F8), deriving from a monoclonal antibody raised against the coat protein of the plant virus AMCV, has been expressed as a functional molecule in the cytoplasm of Escherichia coli, yeast,and plants. Denaturation/renaturation studies indicate that this molecule has high in vitro stability and is capable of refolding to a functional form under reducing conditions.

References

1. Tavladoraki, P., Benvenuto, E., Trinca, S., De Martinis, D., Cattaneo, A. & Galeffi, P. (1993). Transgenic plants expressing a functional single-chain Fv antibody are specifically protected from virus attack. Nature, 366, 469–472.

2. Donini M, Morea V, Desiderio A, Pashkoulov D, Villani ME, Tramontano A, Benvenuto E. Engineering stable cytoplasmic intrabodies with designed specificity. J Mol Biol. 2003 Jul 4;330(2):323-32.

3. Bhat, T. N., Bentley, G. A., Boulot, G., Greene, M. I., Tello, D., Dall’Acqua, W. et al. (1994). Bound water molecules and conformational stabilization help mediate an antigen–antibody association. Proc. Natl Acad. Sci. USA, 91, 1089–1093