Difference between revisions of "Part:BBa K3577002"

 
Line 5: Line 5:
 
PCA3 is a kind of biomarker in prostate cancer tissue. The mRNA of PCA3 can be detected in the urine of patient with prostate cancer. PCA3 almost does not express in other cancers or just a little that can be ignored, so it has high specificity in prostate cancer. Also, the expression of PCA3 mRNA was significantly different between prostate cancer cells and normal cells, which shows a high sensitivity.
 
PCA3 is a kind of biomarker in prostate cancer tissue. The mRNA of PCA3 can be detected in the urine of patient with prostate cancer. PCA3 almost does not express in other cancers or just a little that can be ignored, so it has high specificity in prostate cancer. Also, the expression of PCA3 mRNA was significantly different between prostate cancer cells and normal cells, which shows a high sensitivity.
  
We searched PCA3  on the UCSC Genome Browser (http://genome.ucsc.edu/), a genome browser hosted by UCSC which offers access to genome sequence data. When determining which specific transcript of the gene to use, we chose the transcript with the most amount of exons.  We then copied the sequence of one particular exon shared by multiple transcripts of the gene (NCBI Reference Sequence: NR_132312.1).
 
  
 
<!-- -->
 
<!-- -->
Line 14: Line 13:
 
===Usage and Biology===
 
===Usage and Biology===
  
The PCA3 sequence we uploaded this time is only a fragment of the whole sequence, which is the region amplified by the PCA3 primers.
+
We searched PCA3  on the UCSC Genome Browser (http://genome.ucsc.edu/), a genome browser hosted by UCSC which offers access to genome sequence data. When determining which specific transcript of the gene to use, we chose the transcript with the most amount of exons.  We then copied the sequence of one particular exon shared by multiple transcripts of the gene (NCBI Reference Sequence: NR_132312.1).  The PCA3 sequence we uploaded this time is only a fragment of the whole sequence, which is the region amplified by the PCA3 primers.  
  
 
===Results===
 
===Results===

Latest revision as of 02:13, 23 October 2020


PCA3 mRNA

PCA3 is a kind of biomarker in prostate cancer tissue. The mRNA of PCA3 can be detected in the urine of patient with prostate cancer. PCA3 almost does not express in other cancers or just a little that can be ignored, so it has high specificity in prostate cancer. Also, the expression of PCA3 mRNA was significantly different between prostate cancer cells and normal cells, which shows a high sensitivity.


Sequence and Features


Assembly Compatibility:
  • 10
    INCOMPATIBLE WITH RFC[10]
    Illegal EcoRI site found at 139
  • 12
    INCOMPATIBLE WITH RFC[12]
    Illegal EcoRI site found at 139
  • 21
    INCOMPATIBLE WITH RFC[21]
    Illegal EcoRI site found at 139
  • 23
    INCOMPATIBLE WITH RFC[23]
    Illegal EcoRI site found at 139
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal EcoRI site found at 139
  • 1000
    COMPATIBLE WITH RFC[1000]


Usage and Biology

We searched PCA3 on the UCSC Genome Browser (http://genome.ucsc.edu/), a genome browser hosted by UCSC which offers access to genome sequence data. When determining which specific transcript of the gene to use, we chose the transcript with the most amount of exons. We then copied the sequence of one particular exon shared by multiple transcripts of the gene (NCBI Reference Sequence: NR_132312.1). The PCA3 sequence we uploaded this time is only a fragment of the whole sequence, which is the region amplified by the PCA3 primers.

Results

We obtained three pairs of primers for PCA3, all pairs of primers of PCA3 were verified by PCR ( Polymerase Chain Reaction) before we start following research, the best one pair, PCA3-2,was used in further amplification (FIgure1).

The primer sequence was as follows:

PCA3-2F: GCAAGAGCCACAGAGGGAATG

PCA3-2R: GCGCACTCACCATGAAATGG

Figure1. Primer test for both KLK3 and PCA3

We added a T7 sequence at the 5’ end of forward primer to help start the process of transcription. For the reverse primer, we designed it with a trigger at the 5’ end, so as to add the trigger sequence to the end of PCR product during the process of PCR.

The sequences of these overhang-added primers are as follow :

T-PCA3-2F: taatacgactcactatagggGCAAGAGCCACAGAGGGAATG

T-PCA3-2R: gtttgaatgaattgtaggcttgttatagttatgtttGCGCACTCACCATGAAATGG

The results of PCR showed that the primers with overhang could also amplify PCA3 successfully without significantly affecting the amplification efficiency.

Figure2. PCR efficiency test of two kinds of overhang-added primers