Difference between revisions of "Part:BBa K3577002"
SylviaSong (Talk | contribs) |
|||
Line 3: | Line 3: | ||
<partinfo>BBa_K3577002 short</partinfo> | <partinfo>BBa_K3577002 short</partinfo> | ||
− | + | PCA3 is a kind of biomarker in prostate cancer tissue. The mRNA of PCA3 can be detected in the urine of patient with prostate cancer. PCA3 almost does not express in other cancers or just a little that can be ignored, so it has high specificity in prostate cancer. Also, the expression of PCA3 mRNA was significantly different between prostate cancer cells and normal cells, which shows a high sensitivity. | |
− | + | ||
− | + | ||
− | + | ||
<!-- --> | <!-- --> | ||
Line 12: | Line 9: | ||
<partinfo>BBa_K3577002 SequenceAndFeatures</partinfo> | <partinfo>BBa_K3577002 SequenceAndFeatures</partinfo> | ||
+ | |||
+ | ===Usage and Biology=== | ||
+ | |||
+ | We obtained three pairs of primers for PCA3, all pairs of primers of PCA3 were verified by PCR ( Polymerase Chain Reaction) before we start following research, the best one pair, PCA3-2,was used in further amplification (FIgure1). | ||
+ | The primer sequence was as follows: | ||
+ | PCA3-2F: GCAAGAGCCACAGAGGGAATG | ||
+ | PCA3-2R: GCGCACTCACCATGAAATGG | ||
+ | |||
+ | [[ File: prostate primer test .png|300px|thumb|center|Figure1. Primer test for both KLK3 and PCA3]] | ||
+ | |||
+ | We added a T7 sequence at the 5’ end of forward primer to help start the process of transcription. For the reverse primer, we designed it with a trigger at the 5’ end, so as to add the trigger sequence to the end of PCR product during the process of PCR. The sequences of these overhang-added primers are as follow : | ||
+ | T-PCA3-2F: taatacgactcactatagggGCAAGAGCCACAGAGGGAATG | ||
+ | T-PCA3-2R: gtttgaatgaattgtaggcttgttatagttatgtttGCGCACTCACCATGAAATGG | ||
+ | The results of PCR showed that the primers with overhang could also amplify PCA3 successfully without significantly affecting the amplification efficiency. | ||
+ | |||
+ | [[ File: prostate primer test2 .png|300px|thumb|center|Figure2. PCR efficiency test of two kinds of overhang-added primers]] | ||
<!-- Uncomment this to enable Functional Parameter display | <!-- Uncomment this to enable Functional Parameter display |
Revision as of 05:49, 19 October 2020
PCA3 mRNA
PCA3 is a kind of biomarker in prostate cancer tissue. The mRNA of PCA3 can be detected in the urine of patient with prostate cancer. PCA3 almost does not express in other cancers or just a little that can be ignored, so it has high specificity in prostate cancer. Also, the expression of PCA3 mRNA was significantly different between prostate cancer cells and normal cells, which shows a high sensitivity.
Sequence and Features
- 10INCOMPATIBLE WITH RFC[10]Illegal EcoRI site found at 139
- 12INCOMPATIBLE WITH RFC[12]Illegal EcoRI site found at 139
- 21INCOMPATIBLE WITH RFC[21]Illegal EcoRI site found at 139
- 23INCOMPATIBLE WITH RFC[23]Illegal EcoRI site found at 139
- 25INCOMPATIBLE WITH RFC[25]Illegal EcoRI site found at 139
- 1000COMPATIBLE WITH RFC[1000]
Usage and Biology
We obtained three pairs of primers for PCA3, all pairs of primers of PCA3 were verified by PCR ( Polymerase Chain Reaction) before we start following research, the best one pair, PCA3-2,was used in further amplification (FIgure1). The primer sequence was as follows: PCA3-2F: GCAAGAGCCACAGAGGGAATG PCA3-2R: GCGCACTCACCATGAAATGG
We added a T7 sequence at the 5’ end of forward primer to help start the process of transcription. For the reverse primer, we designed it with a trigger at the 5’ end, so as to add the trigger sequence to the end of PCR product during the process of PCR. The sequences of these overhang-added primers are as follow : T-PCA3-2F: taatacgactcactatagggGCAAGAGCCACAGAGGGAATG T-PCA3-2R: gtttgaatgaattgtaggcttgttatagttatgtttGCGCACTCACCATGAAATGG The results of PCR showed that the primers with overhang could also amplify PCA3 successfully without significantly affecting the amplification efficiency.