Difference between revisions of "Part:BBa K3398000"

(Result)
 
Line 12: Line 12:
 
====Result====
 
====Result====
 
To test the function of mutant promoters, we chose EGFP as our reporter gene.When the E.coli BL21 was cultured at the OD600 between 0.6 to 0.8, we added 1 mM IPTG to induce the expression of EGFP for 20 hours. By assessing the absolute fluorescence and OD600, we can conclude the relative strength of all promoters. Finally we screened out 3 mutants with higher intensity.(<partinfo>K3398000</partinfo>, <partinfo>K3398001</partinfo>, <partinfo>K3398002</partinfo>).
 
To test the function of mutant promoters, we chose EGFP as our reporter gene.When the E.coli BL21 was cultured at the OD600 between 0.6 to 0.8, we added 1 mM IPTG to induce the expression of EGFP for 20 hours. By assessing the absolute fluorescence and OD600, we can conclude the relative strength of all promoters. Finally we screened out 3 mutants with higher intensity.(<partinfo>K3398000</partinfo>, <partinfo>K3398001</partinfo>, <partinfo>K3398002</partinfo>).
[[File:BBa K2965011 measurement.png|center|350px|thumb|'''Figure 1. Strength of wildtype T7 promoter and mutant promoter.'''Relative fluorescent intensity is standardized with fluorescence (excitation wavelength: 485 nm; detection wavelength: 528 nm) per OD600. The intensity of the mutant was significantly higher than that of the wild type.]]
+
[[File:T--ZJU-China--bba 3398000.png|center|350px|thumb|'''Figure 1. Strength of wildtype T7 promoter and mutant promoter.'''Relative fluorescent intensity is standardized with fluorescence (excitation wavelength: 485 nm; detection wavelength: 528 nm) per OD600. The intensity of the mutant was significantly higher than that of the wild type.]]
 
As we can see from the figure, our mutant promoter showed largely increased strength compared with wild type T7 promoter. Therefore, our mutant promoter offer users more opportunity to control the expression of protein using T7 promoter and permit higher levels of target protein expression to be obtained.
 
As we can see from the figure, our mutant promoter showed largely increased strength compared with wild type T7 promoter. Therefore, our mutant promoter offer users more opportunity to control the expression of protein using T7 promoter and permit higher levels of target protein expression to be obtained.
  

Latest revision as of 02:30, 9 October 2020


Enhanced T7 promoter 1

This part is a T7 promoter derived from BBa_I712074 with some point mutation according to previous research , and as a higher expression efficiency relative to BBa_I712074 by the fluorescence intensity when expressing EGFP. To express BioBricks under the control of this part, a T7 polymerase gene is needed in the chassis.

Usage and Biology

T7 promoter is very specific promoter which is transcribed only by specific T7 RNA polymerase. Usually this promoter is used in expression systems where T7 promoter is cotransfected with T7 RNA polymerase. That ensures strong transcription of desired genes.


Characterization

Result

To test the function of mutant promoters, we chose EGFP as our reporter gene.When the E.coli BL21 was cultured at the OD600 between 0.6 to 0.8, we added 1 mM IPTG to induce the expression of EGFP for 20 hours. By assessing the absolute fluorescence and OD600, we can conclude the relative strength of all promoters. Finally we screened out 3 mutants with higher intensity.(BBa_K3398000, BBa_K3398001, BBa_K3398002).

Figure 1. Strength of wildtype T7 promoter and mutant promoter.Relative fluorescent intensity is standardized with fluorescence (excitation wavelength: 485 nm; detection wavelength: 528 nm) per OD600. The intensity of the mutant was significantly higher than that of the wild type.

As we can see from the figure, our mutant promoter showed largely increased strength compared with wild type T7 promoter. Therefore, our mutant promoter offer users more opportunity to control the expression of protein using T7 promoter and permit higher levels of target protein expression to be obtained.

Protocol

1.Linearize pSB1c3 plasmid by reverse PCR (F- ctctagaagcggccgcgaattc/R- tactagtagcggccgctgcag)

2.Obtain the RBS+EGFP sequence and part sequence by PCR (RBS_EGFP_F- aaagaggagaaatactagatgagcaagggc/R- ttacttgtacagctcgtccatg Part_EGFP_F- gcttctagaggtaaaacgacggccagt/R- tctcctctttcaggaaacagctatgac)

3.Use homologous recombination to construct the partX_EGFP pasmid

4.Transform the plasmids into E.coli DH5α, then E.coli BL21 after confirming the sequence results.

5.Coat the transformed BL21 onto the plate added 1mM IPTG.

6.Incubate at 37℃ and observe colony color under the blue light to see if the EGFP is expressed.

7.Pick greener single colonies, add them into 1mL Lb, incubate at 37℃ in a shaker for 6-8h till the OD600 reach 0.6.

8.Add the whole germ solution from last step into 5mL Lb, add IPTG to 1mM and induce for 12h at 30℃.

9.Measure the fluorescence (excitation wavelength: 485 nm; detection wavelength: 528 nm) and OD600.

Reference

[1] Ikeda R A, Ligman C M, Warshamana S, et al. T7 promoter contacts essential for promoter activity in vivo[J]. Nucleic Acids Research, 1992, 20(10): 2517-2524.

[2] Paul S, Stang A, Lennartz K, Tenbusch M, Uberla K. Selection of a T7 promoter mutant with enhanced in vitro activity by a novel multi-copy bead display approach for in vitro evolution[J]. Nucleic Acids Research, 2013, 41(1):e29.

[3] Komura R, Aoki W, Motone K, Satomura A, Ueda M. High-throughput evaluation of T7 promoter variants using biased randomization and DNA barcoding. PLoS One. 2018 May 7;13(5):e0196905.



Sequence and Features


Assembly Compatibility:
  • 10
    INCOMPATIBLE WITH RFC[10]
    Illegal EcoRI site found at 1
    Illegal XbaI site found at 59
  • 12
    INCOMPATIBLE WITH RFC[12]
    Illegal EcoRI site found at 1
  • 21
    INCOMPATIBLE WITH RFC[21]
    Illegal EcoRI site found at 1
  • 23
    INCOMPATIBLE WITH RFC[23]
    Illegal EcoRI site found at 1
    Illegal XbaI site found at 59
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal EcoRI site found at 1
    Illegal XbaI site found at 59
  • 1000
    COMPATIBLE WITH RFC[1000]